<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article
  PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1 20151215//EN" "https://jats.nlm.nih.gov/publishing/1.1/JATS-journalpublishing1.dtd">
<article article-type="research-article" dtd-version="1.1" specific-use="sps-1.9" xml:lang="es" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">av</journal-id>
			<journal-title-group>
				<journal-title>Abanico veterinario</journal-title>
				<abbrev-journal-title abbrev-type="publisher">Abanico vet</abbrev-journal-title>
			</journal-title-group>
			<issn pub-type="ppub">2007-428X</issn>
			<issn pub-type="epub">2448-6132</issn>
			<publisher>
				<publisher-name>Sergio Martínez González</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="doi">10.21929/abavet2021.45</article-id>
			<article-id pub-id-type="other">00129</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Artículos originales</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title><bold>Detección molecular de <italic>Ehrlichia canis, Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic></bold> en caninos domésticos del municipio de Cajeme, Sonora, México</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<name>
						<surname>Aragón-López</surname>
						<given-names>Carlos</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
					<xref ref-type="corresp" rid="c1"><sup>*</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Luna-Nevárez</surname>
						<given-names>Pablo</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Ortiz-Encinas</surname>
						<given-names>Veronica</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Leyva-Corona</surname>
						<given-names>Jose</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Cantú-Soto</surname>
						<given-names>Ernesto</given-names>
					</name>
					<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Reyna-Granados</surname>
						<given-names>Javier</given-names>
					</name>
					<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
					<xref ref-type="corresp" rid="c2"><sup>**</sup></xref>
				</contrib>
			</contrib-group>
			<aff id="aff1">
				<label>1</label>
				<institution content-type="original">Instituto Tecnológico de Sonora, Departamento de Ciencias Agronómicas y Veterinarias, Ciudad Obregón, Sonora. México.</institution>
				<institution content-type="normalized">Instituto Tecnológico de Sonora</institution>
				<institution content-type="orgname">Instituto Tecnológico de Sonora</institution>
				<institution content-type="orgdiv1">Departamento de Ciencias Agronómicas y Veterinarias</institution>
				<addr-line>
					<city>Ciudad Obregón</city>
					<state>Sonora</state>
				</addr-line>
				<country country="MX">Mexico</country>
			</aff>
			<aff id="aff2">
				<label>2</label>
				<institution content-type="original">Instituto Tecnológico de Sonora, Departamento de Biotecnología y Ciencias Alimentarias, Ciudad Obregón, Sonora. México. </institution>
				<institution content-type="normalized">Instituto Tecnológico de Sonora</institution>
				<institution content-type="orgname">Instituto Tecnológico de Sonora</institution>
				<institution content-type="orgdiv1">Departamento de Biotecnología y Ciencias Alimentarias</institution>
				<addr-line>
					<city>Ciudad Obregón</city>
					<state>Sonora</state>
				</addr-line>
				<country country="MX">Mexico</country>
			</aff>
			<author-notes>
				<corresp id="c1">
					<label>*</label>Autor Responsable: Aragón-López Carlos. </corresp>
				<corresp id="c2">
					<label>**</label>Autor para correspondencia: Reyna-Granados Javier. Departamento de Ciencias Agronómicas y Veterinarias, Instituto Tecnológico de Sonora. Antonio Caso 2266, Villa Itson, C.P. 85130, Unidad Obregón, Campus Náinari. Ciudad Obregón, Sonora, México. E-mail: <email>carlos.aragon@itson.edu.mx</email>, <email>pluna@itson.edu.mx</email>, <email>veronica.ortiz@itson.edu.mx</email>, <email>jose.leyva@itson.edu.mx</email>, <email>ernesto.cantu@itson.edu.mx</email>, <email>javier.reyna@itson.edu.mx</email>
				</corresp>
			</author-notes>
			<pub-date date-type="pub" publication-format="electronic">
				<day>28</day>
				<month>02</month>
				<year>2022</year>
			</pub-date>
			<pub-date date-type="collection" publication-format="electronic">
				<season>Jan-Dec</season>
				<year>2021</year>
			</pub-date>
			<volume>11</volume>
			<elocation-id>e129</elocation-id>
			<history>
				<date date-type="received">
					<day>23</day>
					<month>06</month>
					<year>2021</year>
				</date>
				<date date-type="accepted">
					<day>17</day>
					<month>12</month>
					<year>2021</year>
				</date>
			</history>
			<permissions>
				<license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by-nc/4.0/" xml:lang="es">
					<license-p>Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons</license-p>
				</license>
			</permissions>
			<abstract>
				<title>RESUMEN</title>
				<p>Las zoonosis son un problema mundial con un impacto en la salud animal. Este grupo de enfermedades incluye Ehrlichiosis, Anaplasmosis y Rickettsiosis, en las cuales el vector es la garrapata <italic>Riphicephalus sanguineus</italic>, comúnmente conocida como garrapata marrón del perro. Recientes evidencias indican que este microorganismo actúa como vector de agentes zoonóticos bacterianos como <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic>, que han infectado a un gran número de perros y humanos en el norte de México. Este estudio se realizó en el municipio de Cajeme, Sonora, utilizando muestras de sangre (n = 170) de canino. Se utilizaron técnicas moleculares para detectar 92 muestras positivas para <italic>Ehrlichia spp</italic>., 47 para <italic>Ehrlichia canis</italic>, 18 para <italic>Anaplasma platys</italic> y 2 para <italic>Rickettsia spp</italic>. Además, se encontró coinfección con <italic>Ehrlichia canis</italic> en 12 muestras positivas para <italic>Anaplasma platys</italic>. Se realizó la secuenciación de un positivo de cada patógeno, obteniendo 100% de homología en la plataforma &quot;GenBank&quot; (NCBI). Nuestros resultados enfatizaron la importancia del impacto zoonótico y la coinfección de estas enfermedades. Además, este es el primer estudio que confirma la identificación molecular de las especies <italic>Ehrlichia canis, Anaplasma platys y Rickettsia rickettsii</italic>, así como su coinfección, en perros domésticos ubicados en el municipio de Cajeme, Sonora.</p>
			</abstract>
			<kwd-group xml:lang="es">
				<title>Palabras clave:</title>
				<kwd>zoonosis</kwd>
				<kwd>vectores de Ehrlichiosis</kwd>
				<kwd>coinfección</kwd>
				<kwd>técnicas moleculares</kwd>
			</kwd-group>
			<counts>
				<fig-count count="0"/>
				<table-count count="6"/>
				<equation-count count="0"/>
				<ref-count count="46"/>
				<page-count count="1"/>
			</counts>
		</article-meta>
	</front>
	<body>
		<sec sec-type="intro">
			<title>INTRODUCCIÓN</title>
			<p>Las zoonosis involucran varias enfermedades que representan un problema mundial significativo que afecta a la salud humana y animal (García <italic>et al.,</italic> 2013). Dichas enfermedades incluyen Ehrlichiosis, Anaplasmosis y Rickettsiosis que son causadas por una bacteria gramnegativa la cual se caracteriza por un crecimiento intracelular obligado (género <italic>Rickettsia,</italic> familia Rickettsiaceae; género <italic>Ehrlichia</italic> y <italic>Anaplasma</italic>, familia Anaplasmataceae). Estos se transmiten principalmente por ectoparásitos, incluida la garrapata <italic>Riphicephalus sanguineus</italic>, o garrapata marrón del perro, que afecta a los vertebrados terrestre (<xref ref-type="bibr" rid="B29">Parola <italic>et al</italic>., 2009</xref>; <xref ref-type="bibr" rid="B4">Alvarez, 2017</xref>). Varios estudios han demostrado que estos ectoparásitos actúan como vectores de agentes zoonóticos como <italic>Erlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic> (<xref ref-type="bibr" rid="B17">Gaunt <italic>et al</italic>., 2010</xref>).</p>
			<p><italic>E. canis</italic> causa una enfermedad zoonótica en perros, gatos y roedores; el humano es una víctima accidental después de ser picado por la garrapata <italic>Rhipicephalus</italic> alojada en estos animales. Después de la infección, el microorganismo se incuba durante 1-2 semanas y entra en los vasos sanguíneos y linfáticos; luego, viaja al bazo, hígado y ganglios linfáticos para multiplicarse por fusión binaria y extenderse a otros órganos del cuerpo (<xref ref-type="bibr" rid="B10">Castro <italic>et al</italic>., 2004</xref>).</p>
			<p><italic>E. canis</italic> se considera una bacteria de distribución cosmopolita. En México, fue descrita por primera vez en 1996 y clasificada como endémica porque se ha reportado en todo el país, pero principalmente en estados del noroeste como Sonora y Sinaloa. En Sonora, <italic>E. canis</italic> se considera una emergencia sanitaria y un problema de salud pública cada vez mayor. Desde 2002 se han reportado más de 600 casos, la gran mayoría en municipios del norte del estado (<xref ref-type="bibr" rid="B4">Álvarez, 2017</xref>; <xref ref-type="bibr" rid="B39">Sosa <italic>et al</italic>., 2013</xref>).</p>
			<p>Los signos clínicos de la fase aguda de la enfermedad son alteraciones hematológicas, leucopenia, trombocitopenia y anemia leve a moderada; la fase crónica se caracteriza por trombocitopenia, epistaxis, nefropatía, disnea, hepatomegalia, esplenomegalia o linfadenopatía, meningitis inflamatoria o hemorrágica, entre otras (<xref ref-type="bibr" rid="B20">Ismail <italic>et al</italic>., 2010</xref>).</p>
			<p><italic>A. platys</italic> se distribuye en todo el mundo y también es transmitida por las garrapatas <italic>R. sanguineus</italic>. Se describió por primera vez en 1978 en perros de Estados Unidos (<xref ref-type="bibr" rid="B35">Sánchez &amp; Tesouro, 2001</xref>). Esta bacteria pertenece al género Anaplasma (<xref ref-type="bibr" rid="B1">Ábrego <italic>et al.,</italic> 2009</xref>). Causa trombocitopenia cíclica infecciosa canina. La enfermedad puede presentarse con fiebre, anorexia, petequias, uveítis, linfadenopatía generalizada, leucopenia, anemia moderada y especialmente trombocitopenia, que ocurren en episodios de 3-4 días a intervalos de 7-21 días, lo que eventualmente conduce a trombocitopenia crónica con recuperación lenta (<xref ref-type="bibr" rid="B12">Cicuttin <italic>et al</italic>. 2014</xref>).</p>
			<p>Actualmente se ha detectado <italic>A. platys</italic> con baja incidencia en los estados de Coahuila, Durango y Sonora (<xref ref-type="bibr" rid="B3">Almazán <italic>et al</italic>., 2016</xref>; <xref ref-type="bibr" rid="B26">Murrieta <italic>et al.,</italic> 2017</xref>). Como enfermedad zoonótica, <xref ref-type="bibr" rid="B5">Arraga <italic>et al</italic>. (2014</xref>) reportaron dos mujeres en Venezuela que estuvieron expuestas a <italic>R. sanguineus</italic>. Posteriormente se observaron cuerpos de inclusión intraplaquetarios sugestivos de <italic>A. platys</italic> en frotis y se amplificó y secuenció el ADN de</p>
			<p><italic>A. platys</italic> a partir de sangre completa, aunque el tratamiento con doxiciclina no alivió sus síntomas. Estos casos brindan apoyo adicional para <italic>A. platys</italic> como patógeno zoonótico transmitido por garrapatas, muy probablemente de baja patogenicidad; sin embargo, no se ha confirmado la causa de la enfermedad de <italic>A. platys</italic> en humanos. <italic>R. rickettsii</italic> es el principal agente de fiebre maculosa en las Américas; Se han reportado casos en los EE. UU., Canadá, México, Costa Rica, Panamá, Colombia, Brasil y Argentina (<xref ref-type="bibr" rid="B24">López <italic>et al</italic>., 2007</xref>; <xref ref-type="bibr" rid="B19">Herrero <italic>et al</italic>., 2010</xref>; <xref ref-type="bibr" rid="B23">Lebruna <italic>et al</italic>., 2011</xref>), con una alta tasa de mortalidad debido a la detección tardía del patógeno (<xref ref-type="bibr" rid="B27">Oteo <italic>et al</italic>., 2014</xref>). Se considera que México cuenta con las condiciones ideales para el ciclo de transmisión de la enfermedad, comúnmente asociada a las condiciones de vida (pobreza) ya que la mayoría de los casos presentados han sido detectados en zonas marginadas y rurales de México (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>). Estudios recientes demostraron la presencia de <italic>Rickettsia spp</italic>. en garrapatas del estado de Sonora por técnica de PCR (<xref ref-type="bibr" rid="B16">Foley <italic>et al</italic>., 2019</xref>).</p>
			<p>Estos patógenos podrían estar presentes previamente en la garrapata, provocando coinfecciones simultáneas en el huésped (es decir, se puede transmitir más de un agente), lo que provocará la enfermedad al mismo tiempo. Esto puede resultar en la manifestación de signos clínicos, de forma más severa e inespecífica, siendo una desventaja para el diagnóstico clínico por parte de los médicos humanos y veterinarios que atienden estos casos (<xref ref-type="bibr" rid="B2">Alleman &amp; Wamsley, 2008</xref>; <xref ref-type="bibr" rid="B44">Mutz <italic>et al</italic>., 2009</xref>).</p>
			<p>Considerando la importancia zoonótica de estas enfermedades, y que no se han reportado estudios previos en el municipio de Cajeme, Sonora, la presencia de vectores de <italic>E. canis</italic>, <italic>A. platys</italic> y <italic>R. rickettsii</italic> en perros domésticos del municipio son sugestivos a la presencia de estas enfermedades zoonóticas. Por tanto, el objetivo fue la identificación molecular de las especies <italic>E. canis</italic>, <italic>A. platys</italic> y <italic>R. rickettsii</italic> para determinar su coinfección en perros domésticos del municipio de Cajeme, Sonora.</p>
		</sec>
		<sec sec-type="materials|methods">
			<title>MATERIAL Y MÉTODOS</title>
			<sec>
				<title>Tipo de estudio</title>
				<p>Se Desarrollo un estudio de tipo observacional descriptive para detectar la presencia de</p>
				<p><italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic>.</p>
			</sec>
			<sec>
				<title>Área de estudio</title>
				<p>El presente trabajo se realizó a partir de muestras de sangre de perros enviadas al Laboratorio de Biología Molecular de Medicina Veterinaria y Zootecnia del Instituto Tecnológico de Sonora, provenientes de clínicas veterinarias privadas del municipio de Cajeme en el estado de Sonora, México.</p>
			</sec>
			<sec>
				<title>Muestreo experimental</title>
				<p>Utilizamos 170 muestras de sangre entera canina con anticoagulante EDTA de un laboratorio de diagnóstico veterinario comercial ubicado en Ciudad Obregón, Sonora. Solo se seleccionaron caninos con diagnóstico clínico presuntivo o positivo para <italic>E. canis</italic>, <italic>A. platys</italic> y <italic>R. rickettsii</italic> con base en la sintomatología presentada y análisis complementarios realizados, como frotis de sangre y hemogramas. Las muestras fueron transportadas al Laboratorio de Biología Molecular Veterinaria del ITSON y en todos los casos se mantuvieron a 4°C hasta su procesamiento final, por un período no mayor a 24 horas.</p>
			</sec>
			<sec>
				<title>Procesamiento de muestras de sangre</title>
				<p>Las muestras fueron descongeladas y centrifugadas durante 15 minutos a 3,500 rpm para obtener 200 µl de capa de leucoplaquetaria e iniciar la extracción del material genético.</p>
			</sec>
			<sec>
				<title>Extracción de ADN bacteriano</title>
				<p>Para la extracción del ADN de las muestras de sangre, se utilizó el kit comercial DNeasy Blood and Tissue (QIAGEN®) siguiendo las instrucciones del fabricante. La cantidad, calidad y pureza del ADN se midió en un espectrofotómetro automático BioSpect-nano (Shimadzu), y la integridad se observó en gel de agarosa al 1.5% teñido con 1.5 µl de bromuro de etidio.</p>
			</sec>
			<sec>
				<title>Síntesis de controles positivos</title>
				<p>Se utilizó la herramienta BLASTn GenBank® de la base de datos NCBI (National Center for Biotechnology Information) para descargar las secuencias obtenidas de los alineamientos. Dichos alineamientos se realizaron utilizando los cebadores específicos de las bacterias <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic>, en formato FASTA. Se diseñaron los primeros 50 pb (forward) y después 50 pb (reverse) permitiendo así la alineación de los oligonucleótidos. Las secuencias fueron ingresadas a la plataforma IDT (Integrated DNA Technologies) para la síntesis de los fragmentos del gen gBlocks™, facilitando la estandarización para la detección por PCR de cada uno de los microorganismos en estudio.</p>
			</sec>
			<sec>
				<title>Amplificación por PCR</title>
				<p>Las muestras de ADN se analizaron mediante la reacción en cadena de la polimerasa (PCR) utilizando los conjuntos de cebadores descritos en la <xref ref-type="table" rid="t1">Tabla 1</xref>. Inicialmente, los ensayos de PCR se dirigieron a los géneros <italic>Eherlichia spp.</italic>, <italic>Anaplasma spp.</italic> y <italic>Rickettsia spp.</italic> Las muestras que dieron positivo para cada género se sometieron a una segunda PCR con cebadores específicos para <italic>E. canis</italic>, <italic>A. platys</italic> y <italic>R. rickettsii</italic>.</p>
				<p>
					<table-wrap id="t1">
						<label>Tabla 1</label>
						<caption>
							<title>Cebadores utilizados para detección del agente en muestras de sangre canina</title>
						</caption>
						<table>
							<colgroup>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
								<col/>
							</colgroup>
							<thead>
								<tr>
									<th align="center">Agente</th>
									<th align="center">Cebadores (5’-3’)</th>
									<th align="center">Gen</th>
									<th align="center">pb</th>
									<th align="center">Cebador Tm</th>
									<th align="center">Identificación de secuencias</th>
									<th align="center">Referencia</th>
								</tr>
							</thead>
							<tbody>
								<tr>
									<td align="justify"><italic>Ehrlichia</italic> spp.</td>
									<td align="justify">ECC-AGAACGAACGCTGGCGGCAAGCC ECB-CGTATTACCGCGGCTGCTGGC</td>
									<td align="center">16S</td>
									<td align="center">478</td>
									<td align="center">61 °C</td>
									<td align="center">MH020203.1</td>
									<td align="center">Dawson <italic>et al.</italic> (1996)</td>
								</tr>
								<tr>
									<td align="justify"><italic>Rickettsia</italic> spp.</td>
									<td align="justify">CS78-GCAAGTATCGGTGAGGATGTAAT Cs323-GCTTCCTTAAAATTCAATAAATCAGGAT</td>
									<td align="center"><italic>gltA</italic></td>
									<td align="center">401</td>
									<td align="center">48 °C</td>
									<td align="center">MG717529.1</td>
									<td align="center">Labruna <italic>et al.</italic> (2004)</td>
								</tr>
								<tr>
									<td align="justify"><italic>Ehrlichia canis</italic></td>
									<td align="justify">HE-TATAGGTACCGTCATTATCTTCCCTAT ECA-CAATTATTTATAGCCTCTGGCTATAGGAA</td>
									<td align="center">16S</td>
									<td align="center">389</td>
									<td align="center">57.4 ºC</td>
									<td align="center">KX818219.1</td>
									<td align="center">Murphy <italic>et al.</italic> (1998)</td>
								</tr>
								<tr>
									<td align="justify">Anaplasma platys</td>
									<td align="justify">pla-HS475-AAGGCGAAAGAAGCAGTCTTA pla-HS1198-CATAGTCTGAAGTGGAGGAC</td>
									<td align="center"><italic>groEl</italic></td>
									<td align="center">724</td>
									<td align="center">58 ºC</td>
									<td align="center">EU516386.1</td>
									<td align="center">Inokuma <italic>et al</italic>., 2002</td>
								</tr>
								<tr>
									<td align="justify"><italic>Rickettsia rickettsii</italic></td>
									<td align="justify">Rr190.70p-ATGGCGAATATTTCTCCAAAA Rr190.602n-AGTGCAGCATTCGCTCCCCCT</td>
									<td align="center">ompA</td>
									<td align="center">530</td>
									<td align="center">48 °C</td>
									<td align="center">U55822.1</td>
									<td align="center">Regnery <italic>et al.</italic>, 1991</td>
								</tr>
							</tbody>
						</table>
					</table-wrap>
				</p>
				<p>Para las reacciones se utilizó el kit precargado GoTaq® Flexi DNA Polymerase PCR (Promega) que contiene Green GoTaq®, que sirve como tampón de reacción y solución de carga de gel, lo que permite cargar las reacciones directamente para un análisis rápido y eficiente. Las reacciones se realizaron en un volumen final de 25 μl, comenzando con las concentraciones del fabricante: 1X Green GoTaq Buffer 5x, 1.5 mM MgCl2, 0.2 mM para cada dNTP, 0.4 μM de cada cebador, 1.25 u de GoTaq DNA Polymerase, 2 μl de DNA y H2O libre de nucleasas a 25 µL. El producto se identificó en gel de agarosa al 1.5% y bromuro de etidio, considerando bandas positivas con el tamaño de cada agente.</p>
			</sec>
			<sec>
				<title>Secuenciación y análisis en silico de fragmenmtos amplificados</title>
				<p>Un producto de PCR de cada microorganismo que resultó positivo, también se purificó con el kit comercial Wizard® SV Gel and PCR Clean-Up System (Promega) para corroborar que el fragmento amplificado pertenece a las regiones de interés. Luego, los amplicones fueron secuenciados utilizando el proceso de Sanger realizado en la unidad Langebio Cimvestav Lab Irapuato. Los fragmentos generados con secuencias de nucleótidos representativas de cada bacteria fueron analizados con el programa Snapgene Viewer, y sometidos al algoritmo BLASTn para evaluar el porcentaje de homología de cada agente con las secuencias disponibles en la base de datos GenBank.</p>
			</sec>
		</sec>
		<sec sec-type="results">
			<title>RESULTADOS</title>
			<p>Se observó por medio de electroforesis, una buena integridad de las moléculas de ADN bacteriano extraído, con una cuantificación por espectrofotometría de 248.32 ng/µl en las muestras y una pureza con la relación 260-280 en promedio de 1.85, partiendo de sangre entera con EDTA.</p>
			<p>Para la técnica de PCR se utilizó una concentración de 0.5 ng/µl de cada gblocks como controles positivos, obteniendo los pb correspondientes de cada agente, logrando una buena eficiencia y rapidez para la estandarización molecular con las condiciones específicas de cada agente patógeno.</p>
			<p>El número de casos positivos y la frecuencia de <italic>Ehrlichis spp., Ehrlichia canis, Anaplasma platys</italic> y <italic>Rickettsia spp.</italic> obtenidos del análisis molecular de muestras de sangre canina (n=170) se describen en la <xref ref-type="table" rid="t2">Tabla 2</xref>. De las 92 muestras que dieron positivo para Ehrlichia spp. Se encontraron 12 coinfecciones (<xref ref-type="table" rid="t3">Tabla 3</xref>) de <italic>Ehrlichia canis</italic> con <italic>Anaplasma platys</italic> (Género EA) (13%).</p>
			<p>
				<table-wrap id="t2">
					<label>Tabla 2</label>
					<caption>
						<title>Número de casos e incidencia de <italic>Ehrlichia canis Anaplasma platys</italic> y <italic>Rickettsia rickettsi</italic> en perros de Cajeme, Sonora, mediante PCR (n=170)</title>
					</caption>
					<table>
						<colgroup>
							<col/>
							<col span="2"/>
						</colgroup>
						<thead>
							
						
						<tr>
								<th align="justify">Agente</th>
								<th align="center" colspan="2">PCR </th>
							</tr>
							<tr>
								<th align="justify"> </th>
								<th align="justify">Positivos</th>
								<th align="justify">Frecuencia</th>
							</tr></thead>
						<tbody>
							<tr>
								<td align="justify"><italic>Ehrlichia spp</italic></td>
								<td align="justify">92</td>
								<td align="justify">54%</td>
							</tr>
							<tr>
								<td align="justify"><italic>Ehrlichia canis</italic></td>
								<td align="justify">47</td>
								<td align="justify">28%</td>
							</tr>
							<tr>
								<td align="justify"><italic>Anaplasma platys</italic></td>
								<td align="justify">18</td>
								<td align="justify">11%</td>
							</tr>
							<tr>
								<td align="justify"><italic>Rickettsia spp.</italic></td>
								<td align="justify">2</td>
								<td align="justify">0.8%</td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</p>
			<p>
				<table-wrap id="t3">
					<label>Tabla 3</label>
					<caption>
						<title>Co-infecciones y frecuencia en perros positivos al género EA</title>
					</caption>
					<table>
						<colgroup>
							<col/>
							<col/>
						</colgroup>
						<tbody>
							<tr>
								<td align="justify"><italic>Co-infecciones</italic></td>
								<td align="justify">PCR</td>
							</tr>
							<tr>
								<td align="justify"><italic>(E. canis / A. platys)</italic></td>
								<td align="justify">Positivos 92</td>
							</tr>
							<tr>
								<td align="justify">Positivos</td>
								<td align="justify">12</td>
							</tr>
							<tr>
								<td align="justify">Frecuencia</td>
								<td align="justify">13%</td>
							</tr>
						</tbody>
					</table>
				</table-wrap>
			</p>
			<p>Además, se realizó la secuenciación de una muestra de cada positivo para las diferentes especies de microorganismos analizados, obteniendo cromatogramas puros los cuales fueron analizados con el programa SanpGene Viewer. El análisis de las secuencias en el programa BLASTn (Centro Nacional de Información Biotecnológica) detectó una similitud entre el 99 y el 100% con las secuencias reportadas previamente.</p>
		</sec>
		<sec sec-type="discussion">
			<title>DISCUSIÓN</title>
			<p>Los microorganismos del orden Rickettsiales presentan condiciones zoonóticas denominadas Rickettsiosis, Ehrlichiosis y Anaplasmosis que se deben a varios patógenos de importancia veterinaria que han ganado terreno no solo en nuestra región sino también a nivel mundial (<xref ref-type="bibr" rid="B32">Rodríguez <italic>et al</italic>. 2016</xref>), esto se debe principalmente a su vector <italic>Rhipicephalus sanguineus</italic>, siendo la especie de garrapata más reportada y con mayor distribución geográfica (<xref ref-type="bibr" rid="B40">Sosa <italic>et al</italic>., 2016</xref>; <xref ref-type="bibr" rid="B6">Cabezas-Cruz <italic>et al</italic>., 2019</xref>). Estos patógenos van en aumento debido a la actividad del ser humano que ha generado cambios radicales en el medio ambiente, favoreciendo las enfermedades transmitidas por vectores (<xref ref-type="bibr" rid="B41">Suthers, 2004</xref>) y aumentando su prevalencia a finales de primavera y verano debido a que estos ectoparásitos aumentan su actividad en las altas temperaturas ambientales durante estas estaciones del año, inoculando más rápidamente los hemoparásitos mencionados (<xref ref-type="bibr" rid="B29">Parola <italic>et al</italic>., 2009</xref>), siendo necesaria la estandarización de técnicas precisas para la detección de estos microorganismos zoonóticos del orden Rickettsiales en las regiones Tropicales y Subtropicales.</p>
			<p>Actualmente, el uso de fragmentos del gen gBlocks como controles positivos utilizados en este estudio se ha vuelto popular como estándares y positivos sintéticos para la detección de microorganismos bacterianos. Actualmente se reportaron datos similares en Barcelona donde se utilizaron este tipo de fragmentos para la detección de <italic>E. coli, E. faecalis</italic> y <italic>Legionella pneumiphilia</italic> (<xref ref-type="bibr" rid="B7">Cardenas, 2018</xref>); además, en Australia dichos fragmentos se utilizaron como estándares en la detección por PCR multiplex de <italic>Taenia spp</italic>. (<xref ref-type="bibr" rid="B45">Ng-Nguyen <italic>et al</italic>., 2017</xref>) Por lo tanto, se recomienda el uso de gBlocks para la estandarización de PCR ya que aumentó la velocidad del bioensayo en la detección debido a la falta de disponibilidad de aislados biológicos.</p>
			<p>El estudio fue el primer trabajo mediante PCR para detectar las especies <italic>Ehrlichia canis, Anaplasma platys</italic> y <italic>Rickettsia rickettsi</italic> en muestras de sangre de perros en el municipio de Cajeme y en Sonora, permitiendo conocer la distribución geográfica ampliada de los tres patógenos en el estado. El porcentaje de 54% a al menos un agente patógeno en nuestro estudio concuerda con investigaciones realizadas con herramientas moleculares en algunos países de América del Sur y Central, donde Brasil reportó 69% (<xref ref-type="bibr" rid="B42">Tanikawa et al., 2013</xref>), Nicaragua 80% (<xref ref-type="bibr" rid="B46">Wei <italic>et al</italic>., 2014</xref>), Panamá 70,6% (<xref ref-type="bibr" rid="B36">Santamaria <italic>et al</italic>., 2014</xref>), Costa Rica 45% (<xref ref-type="bibr" rid="B33">Rojas <italic>et al</italic>., 2015</xref>) y El Salvador 60% (<xref ref-type="bibr" rid="B25">Miranda <italic>et al</italic>., 2018</xref>). Nuestro porcentaje de prevalencia difirió al compararlo con porcentajes altos de otros países, probablemente por trabajar con perros sin dueño y por estar más en contacto con el vector de las enfermedades al estar asociado a condiciones de vida en zonas marginadas (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>). Se ha reportado prevalencia a hemoparásitos en algunos otros estados de México, donde Sinaloa reporta 74.3% (<xref ref-type="bibr" rid="B39">Sosa-Gutiérrez <italic>et al</italic>., 2013</xref>), Coahuila y Durango 41% (<xref ref-type="bibr" rid="B3">Almazán et al., 2016</xref>), Yucatán 69% (<xref ref-type="bibr" rid="B14">Díaz <italic>et al</italic>., 2016</xref>), Chihuahua 40% (<xref ref-type="bibr" rid="B15">Escárcega <italic>et al.</italic>, 2018</xref>) y Sonora 33% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>). Como se mencionó anteriormente, Cajeme presentó el 57% de la infección, posicionando a Sonora en este momento como uno de los principales estados con mayor incidencia en las regiones tropicales y subtropicales donde están presentes los parásitos y el vector.</p>
			<p>Con respecto al porcentaje de presencia de cada hemoparásito, evidencio nuestro estudio una prevalencia mayor de <italic>E. Canis</italic> a lo reportado en México (28%), ya que en otro estudio de Sonora en el municipio de San Luis Rio Colorado, se encontró del 8% de infección para E. <italic>Canis</italic> en muestras sanguíneas de 235 perros (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>), en el Estado de Coahuila y Durango 10% en una población de 100 perros sanos infestados con garrapatas (<xref ref-type="bibr" rid="B3">Almazán <italic>et al</italic>., 2016</xref>). En Yucatán se determinó el 36% en una población de 50 perros (10 perros domésticos y 40 en un centro de control de animales), en donde todos los perros positivos fueron de muestras recolectadas del refugio de animales, lo que representa una prevalencia, para este sitio de muestreo del 45% (<xref ref-type="bibr" rid="B28">Path <italic>et al</italic>., 2015</xref>). También existes hallazgo en otros países como Buenos Aires, Argentina, en donde los resultados fueron de igual manera inferiores en una población de 223 perros, obteniendo el 6.7% de positivos a <italic>E. Canis</italic> (<xref ref-type="bibr" rid="B13">Cicuttin, 2016</xref>), Uruguay es uno de los pocos países en los cuales reporta presencia de otros hemoparásitos, pero no la presencia de <italic>E. Canis</italic> en una población de 191 perros (<xref ref-type="bibr" rid="B8">Carvalho, 2017</xref>). En contraste con Brasil, el porcentaje de nuestro estudio es menor, en donde trabajaron con 472 perros en el noreste brasilero encontraron el 34.5% de los perros positivos (<xref ref-type="bibr" rid="B38">Silva <italic>et al.</italic>, 2010</xref>), siendo superior a nuestros resultados. Colombia representa la mayor zona de alta prevalencia revisada sobre E. canis en sus municipios de Palmira (92.8%) y Cartago (90%) (<xref ref-type="bibr" rid="B34">Rojas <italic>et al</italic>., 2013</xref>). No obstante, cabe mencionar que dicho trabajo se realizó en perros callejeros a diferencia de nuestro estudio.</p>
			<p>La presencia de <italic>Anaplasma platys</italic> (11%) en nuestro estudio, resultó ser superiores a los reportados en Buenos Aires, Argentina de 223 perros, siendo positivos para <italic>A. platys</italic> el 7.2% (<xref ref-type="bibr" rid="B13">Cicuttin, 2016</xref>). En Uruguay de 191 perros resultaron positivos el 4.2% (<xref ref-type="bibr" rid="B8">Carvalho, 2017</xref>). También en San Luis Rio Colorado, Sonora en 235 muestras caninas fueron positivas para el 18% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>). Otras publicaciones muestran valores similares a Costa Rica con el 10% (<xref ref-type="bibr" rid="B46">Wei <italic>et al</italic>., 2014</xref>), Nicaragua el 13% (<xref ref-type="bibr" rid="B33">Rojas <italic>et al</italic>., 2014</xref>), Cuba el 16% (<xref ref-type="bibr" rid="B37">Silva <italic>et al</italic>., 2016</xref>) y el Salvador con 17% (<xref ref-type="bibr" rid="B26">Murrieta, 2017</xref>), pero resultaron ser inferior con respecto a Panamá con el 21.3%. En Brasil, en una población de 100 perros, se obtuvo mayor prevalencia para <italic>Anaplasma platys</italic> con el 21% y 9% para <italic>Ehrlichia</italic>, siendo uno de los pocos estudios que difiere en nuestros resultados, ya que, en nuestro trabajo y la mayoría de las investigaciones realizadas en centro y Sudamérica, reportan una menor incidencia de <italic>A. Platys</italic> que de <italic>E. canis</italic>.</p>
			<p>El diagnóstico molecular en nuestra investigación de hemoparásitos relacionados a <italic>Ehrlichia</italic> y <italic>Anaplasma</italic> han sido sencillo de identificar a diferencia de la bacteria <italic>Rickettsia rickettsii</italic> con la técnica de PCR a partir de muestras sanguíneas en caninos. Nuestro porcentaje de prevalencia a este agente fuel el menor (0.8%) a comparación de <italic>E. canis</italic> y <italic>A. platys</italic>, esto puede deberse a que típicamente se menciona que circula un bajo número de rickettsias en la sangre en ausencia de enfermedad avanzada o infección fulminante (<xref ref-type="bibr" rid="B11">CDC, 2017</xref>; <xref ref-type="bibr" rid="B43">Tinoco <italic>et al</italic>., 2018</xref>).</p>
			<p>Debido a esto encontramos en la literatura diferentes investigaciones, en su mayoría dirigidas al diagnóstico de <italic>Rickettsia spp.</italic> y <italic>R. rickettsii</italic> en garrapatas <italic>R. sanguineus</italic> en perros de diferentes regiones, como es el caso de Yucatán, seleccionando 28 perros donde se colectaron 106 garrapatas <italic>Rhipicephalus sanguineus</italic> con una incidencia del 26% (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>) En Matamoros, Coahuila, se realizó la técnica de PCR de punto final para el análisis de 100 garrapatas (<italic>Rhipicephalus sanguineus</italic>) dando como positivo a <italic>Rickettsia spp</italic> el 4% de las muestras analizadas (<xref ref-type="bibr" rid="B9">Castillo <italic>et al</italic>., 2015</xref>). En Mexicali Baja California, México, se analizaron mediante PCR garrapatas de perro pertenecientes a la morfología de <italic>Rhipicephalus sanguineus</italic>, resultando muestras positivas con 100% de homología a <italic>R. rickettsii</italic> (<xref ref-type="bibr" rid="B16">Foley <italic>et al.</italic>, 2019</xref>). Actualmente Sonora lidera las entidades con más reportes de Rickettsiosis en el país, siendo Cajeme una de las principales ciudades con más casos de muerte, a pesar de ser un dato asociado a la salud pública, es importante conocer la incidencia de <italic>R. rickettsii</italic> en animales ((<xref ref-type="bibr" rid="B31">PSS, 2014</xref>), dándole mayor importancia a nuestro trabajo, pues no solo se detectó Rickettsia spp. Debido a que esas muestras salieron positivas a <italic>R. rickettsii</italic>, con 100% de homología al género con el gen gltA y la especie con el gen OmpA en muestras de sangre de 2 perros (n = 170), estos genes son los más utilizados para la detección de la bacteria que causan la fiebre maculosa.</p>
			<p>Los resultados obtenidos de los tres agentes, aumenta la alerta y la incidencia de casos asociados a las Rickettsiales en el estado de Sonora transmitida por la garrapata café <italic>Riphicephalus sanguineus</italic>, que actualmente es el vector más importante de Rickettsiales en México (<xref ref-type="bibr" rid="B22">Labruna, 2009</xref>), constituyendo un problema de salud pública, pues se le consideran a <italic>R. rickettsii</italic>, <italic>E. canis</italic> y <italic>A. platys</italic> enfermedad zoonótica por la CDC en el 2017 y que al pasar de los años han adquirido mayor territorio de infección. Como se mencionó anteriormente, estos patógenos pueden estar presentes en la garrapata, provocando co-infecciones simultáneas en el hospedero, es decir más de un solo agente puede ser transmitido, como se demuestra en la presente investigación, encontrando el 13% de co-infección a los agentes <italic>E. canis</italic> y <italic>A. platys</italic>.</p>
			<p>La presencia de co-infección con estas bacterias en nuestro estudio no es un hallazgo extraño, ya que son los más comunes en Latinoamérica<italic>,</italic> basándonos en algunos porcentajes similares obtenidos en Panamá, que reportan una co-infecciones entre <italic>E. canis</italic> y <italic>A. platys</italic> del 7.5% (<xref ref-type="bibr" rid="B36">Santamaría <italic>et al</italic>., 2014</xref>), El Salvador con 4.5% (<xref ref-type="bibr" rid="B25">Miranda <italic>et al., 2018</italic></xref>) y San Luis Rio Colorado, Sonora con el 12.2% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>), mencionando que este último es muy semejante a nuestros resultados de co-infeccion y es del mismo estado.</p>
			<p>Es fundamental considerar que el 46% restante de las muestras negativas en el estudio a género y especie, debido a la ausencia de los patógenos o a la presencia de otras enfermedades, ya que en la investigación todas las muestras de sangre provenían de presuntos perros o que manifestaban síntomas clínicos, aunque también puede deberse a la presencia en cantidades bajas e indetectables de los agentes patológicos.</p>
			<p>Finalmente, es importante resaltar que las diferencias encontradas entre las muestras positivas a género y negativas a <italic>E. canis, A. platys y R. rickettsi</italic> probablemente se deban a que los cebadores utilizados en la primera PCR de género (ECC/ ECB) también amplifican otras especies, lo que podría indicar infección por otras especies de Ehrlichia (<italic>E. ewingii</italic> u otras) u otras especies de la familia Anaplasmataceae (<italic>A. phagocytophilum</italic> u otras).</p>
		</sec>
		<sec sec-type="conclusions">
			<title>CONCLUSIONES</title>
			<p>El porcentaje de hemoparásitos en perros domésticos reportado en este estudio, posiciona actualmente a Sonora como uno de los principales estados con mayor frecuencia en regiones tropicales y subtropicales. Los tres agentes fueron detectados por técnicas moleculares en sangre de perros sospechosos de la ciudad de Cajeme, Sonora, identificándose <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic> con frecuencias de 28%, 11% y 0.8%, respectivamente. Además, estos tres agentes fueron confirmados por secuenciación. En cuanto a las co-infecciones, solo se detectaron simultáneamente <italic>Ehrlichia canis</italic> y <italic>Anaplasma platys</italic> con un 13% de frecuencia. Esta es la primera investigación de identificación molecular en nuestro estado, confirmando la presencia de <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> y <italic>Rickettsia rickettsii</italic> a partir de sangre total de caninos.</p>
		</sec>
	</body>
	<back>
		<ref-list>
			<title>LITERATURA CITADA</title>
			<ref id="B1">
				<mixed-citation>Ábrego L, Dolz G, Romero J, Bernardo V, Meneses A. 2009. Detección molecular de <italic>Anaplasma platys</italic> en perros de Costa Rica. <italic>Ciencias Veterinarias</italic>. 27(2):71-80. ISSN: 0250-5649. <ext-link ext-link-type="uri" xlink:href="http://www.revistas.una.ac.cr/index.php/veterinaria/article/view/4984/4778">http://www.revistas.una.ac.cr/index.php/veterinaria/article/view/4984/4778</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ábrego</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Dolz</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Romero</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Bernardo</surname>
							<given-names>V</given-names>
						</name>
						<name>
							<surname>Meneses</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Detección molecular de Anaplasma platys en perros de Costa Rica</article-title>
					<source>Ciencias Veterinarias</source>
					<volume>27</volume>
					<issue>2</issue>
					<fpage>71</fpage>
					<lpage>80</lpage>
					<issn>0250-5649</issn>
					<ext-link ext-link-type="uri" xlink:href="http://www.revistas.una.ac.cr/index.php/veterinaria/article/view/4984/4778">http://www.revistas.una.ac.cr/index.php/veterinaria/article/view/4984/4778</ext-link>
				</element-citation>
			</ref>
			<ref id="B2">
				<mixed-citation>Alleman R, Wamsley HL. 2008. An update on anaplasmosis in dogs. <italic>Veterinary Medicine</italic>. 103. <ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/publication/288555993_An_update_on_anaplasmosis_in_ dogs">https://www.researchgate.net/publication/288555993_An_update_on_anaplasmosis_in_ dogs</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Alleman</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Wamsley</surname>
							<given-names>HL.</given-names>
						</name>
					</person-group>
					<year>2008</year>
					<article-title>An update on anaplasmosis in dogs</article-title>
					<source>Veterinary Medicine</source>
					<volume>103</volume>
					<ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/publication/288555993_An_update_on_anaplasmosis_in_ dogs">https://www.researchgate.net/publication/288555993_An_update_on_anaplasmosis_in_ dogs</ext-link>
				</element-citation>
			</ref>
			<ref id="B3">
				<mixed-citation>Almazán C, González VH, Fernández IG, Cabezas A, Rodríguez R, de la Fuente J. 2016. Molecular identification and characterization of <italic>Anaplasma platys</italic> and <italic>Ehrlichia canis</italic> in dogs in Mexico. <italic>Ticks and Tick-borne Diseases</italic>. 7(2):276-283. ISSN: 1877-959X. https://doi.org/10.1016/j.ttbdis.2015.11.002</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Almazán</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>González</surname>
							<given-names>VH</given-names>
						</name>
						<name>
							<surname>Fernández</surname>
							<given-names>IG</given-names>
						</name>
						<name>
							<surname>Cabezas</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Rodríguez</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>de la Fuente</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Molecular identification and characterization of Anaplasma platys and Ehrlichia canis in dogs in Mexico</article-title>
					<source>Ticks and Tick-borne Diseases</source>
					<volume>7</volume>
					<issue>2</issue>
					<fpage>276</fpage>
					<lpage>283</lpage>
					<issn>1877-959X</issn>
					<pub-id pub-id-type="doi">10.1016/j.ttbdis.2015.11.002</pub-id>
				</element-citation>
			</ref>
			<ref id="B4">
				<mixed-citation>Álvarez R. 2017. Revisión sobre la biología de <italic>Rhiphicephalus sanguineus</italic> (ARTHROPODA, CHELICERATA) (LATREILLE, 1806). <italic>Sustainability, Agri, Food and Environmental Research</italic>. 5(1):11-16. https://doi.org/10.7770/safer-V5N1-art1173</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Álvarez</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Revisión sobre la biología de Rhiphicephalus sanguineus (ARTHROPODA, CHELICERATA) (LATREILLE, 1806)</article-title>
					<source>Sustainability, Agri, Food and Environmental Research</source>
					<volume>5</volume>
					<issue>1</issue>
					<fpage>11</fpage>
					<lpage>16</lpage>
					<pub-id pub-id-type="doi">10.7770/safer-V5N1-art1173</pub-id>
				</element-citation>
			</ref>
			<ref id="B5">
				<mixed-citation>Arraga CM, Parra OC, Hegarty BC, Breitschwerdt EB, Qurollo BA, Berrueta MA. 2014. Molecular Evidence of <italic>Anaplasma platys</italic> Infection in Two Women from Venezuela. <italic>The American Journal of Tropical Medicine and Hygiene</italic>. 91(6):1161-1165. ISSN: 0002-9637. https://doi.org/10.4269/ajtmh.14-0372</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Arraga</surname>
							<given-names>CM</given-names>
						</name>
						<name>
							<surname>Parra</surname>
							<given-names>OC</given-names>
						</name>
						<name>
							<surname>Hegarty</surname>
							<given-names>BC</given-names>
						</name>
						<name>
							<surname>Breitschwerdt</surname>
							<given-names>EB</given-names>
						</name>
						<name>
							<surname>Qurollo</surname>
							<given-names>BA</given-names>
						</name>
						<name>
							<surname>Berrueta</surname>
							<given-names>MA.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Molecular Evidence of Anaplasma platys Infection in Two Women from Venezuela</article-title>
					<source>The American Journal of Tropical Medicine and Hygiene</source>
					<volume>91</volume>
					<issue>6</issue>
					<fpage>1161</fpage>
					<lpage>1165</lpage>
					<issn>0002-9637</issn>
					<pub-id pub-id-type="doi">10.4269/ajtmh.14-0372</pub-id>
				</element-citation>
			</ref>
			<ref id="B6">
				<mixed-citation>Cabezas-Cruz A, Allain E, Ahmad AS, Saeed MA, Rashid I, Ashraf K, Estrada-Peña A. 2019. Low genetic diversity of <italic>Ehrlichia canis</italic> associated with high co-infection rates in <italic>Rhipicephalus sanguineus</italic> (sl). <italic>Parasites &amp; Vectors</italic>. 12:12. https://doi.org/10.1186/s13071-018-3194-9</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cabezas-Cruz</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Allain</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Ahmad</surname>
							<given-names>AS</given-names>
						</name>
						<name>
							<surname>Saeed</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Rashid</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Ashraf</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Estrada-Peña</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2019</year>
					<article-title>Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (sl)</article-title>
					<source>Parasites &amp; Vectors</source>
					<volume>12</volume>
					<fpage>12</fpage>
					<lpage>12</lpage>
					<pub-id pub-id-type="doi">10.1186/s13071-018-3194-9</pub-id>
				</element-citation>
			</ref>
			<ref id="B7">
				<mixed-citation>Cardenas YI. 2018. Determinación de la contaminación microbiológica del agua de riego aplicando nuevas estrategias de análisis. <italic>Tesis de</italic> 
					<italic>doctorado</italic>, <italic>Universidad de Barcelona</italic>. España. <ext-link ext-link-type="uri" xlink:href="http://www.file:///C:/Users/74998/Downloads/YICY_TESIS.pdf">http://www.file:///C:/Users/74998/Downloads/YICY_TESIS.pdf</ext-link>
				</mixed-citation>
				<element-citation publication-type="thesis">
					<person-group person-group-type="author">
						<name>
							<surname>Cardenas</surname>
							<given-names>YI.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<source>Determinación de la contaminación microbiológica del agua de riego aplicando nuevas estrategias de análisis</source><italic>Tesis de</italic><comment content-type="degree">doctorado</comment>
					<publisher-name>Universidad de Barcelona</publisher-name>
					<publisher-loc>España</publisher-loc>
					<ext-link ext-link-type="uri" xlink:href="http://www.file:///C:/Users/74998/Downloads/YICY_TESIS.pdf">http://www.file:///C:/Users/74998/Downloads/YICY_TESIS.pdf</ext-link>
				</element-citation>
			</ref>
			<ref id="B8">
				<mixed-citation>Carvalho L, Armua MT, Sosa N, Félix ML, Venzal JM. 2017. <italic>Anaplasma platys</italic> in dogs from Uruguay. <italic>Ticks Tick Borne Dis</italic>. 8(2):241-245. https://doi.org/10.1016/j.ttbdis.2016.11.005</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Carvalho</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Armua</surname>
							<given-names>MT</given-names>
						</name>
						<name>
							<surname>Sosa</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Félix</surname>
							<given-names>ML</given-names>
						</name>
						<name>
							<surname>Venzal</surname>
							<given-names>JM.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Anaplasma platys in dogs from Uruguay</article-title>
					<source>Ticks Tick Borne Dis</source>
					<volume>8</volume>
					<issue>2</issue>
					<fpage>241</fpage>
					<lpage>245</lpage>
					<pub-id pub-id-type="doi">10.1016/j.ttbdis.2016.11.005</pub-id>
				</element-citation>
			</ref>
			<ref id="B9">
				<mixed-citation>Castillo M, Cueto SM, Hernández Sergio, Gallegos MA, Valdéz M, Sánchez FJ, Ortega AI. 2015. Detección de Rickettsia sp. en la garrapata café del perro <italic>Rhipicephalus sanguineus</italic> (Acari: Ixodidae) en Matamoros, Coahuila, México. <italic>Acta Zoológica Mexicana</italic>. 31(1):80-83. <ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S0065-17372015000100011&amp;lng=es&amp;tlng=es">http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S0065-17372015000100011&amp;lng=es&amp;tlng=es</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Castillo</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Cueto</surname>
							<given-names>SM</given-names>
						</name>
						<name>
							<surname>Sergio</surname>
							<given-names>Hernández</given-names>
						</name>
						<name>
							<surname>Gallegos</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Valdéz</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Sánchez</surname>
							<given-names>FJ</given-names>
						</name>
						<name>
							<surname>Ortega</surname>
							<given-names>AI.</given-names>
						</name>
					</person-group>
					<year>2015</year>
					<article-title>Detección de Rickettsia sp. en la garrapata café del perro Rhipicephalus sanguineus (Acari: Ixodidae) en Matamoros, Coahuila, México</article-title>
					<source>Acta Zoológica Mexicana</source>
					<volume>31</volume>
					<issue>1</issue>
					<fpage>80</fpage>
					<lpage>83</lpage>
					<ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S0065-17372015000100011&amp;lng=es&amp;tlng=es">http://www.scielo.org.mx/scielo.php?script=sci_arttext&amp;pid=S0065-17372015000100011&amp;lng=es&amp;tlng=es</ext-link>
				</element-citation>
			</ref>
			<ref id="B10">
				<mixed-citation>Castro MB, Machado RZ, Aquino LP, Alessi AC and. Costa MT. 2004. Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findings. <italic>Veterinary Parasitology</italic>. 1(119):73-86. ISSN:0304-4017. https://doi.org/10.1016/j.vetpar.2003.10.012</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Castro</surname>
							<given-names>MB</given-names>
						</name>
						<name>
							<surname>Machado</surname>
							<given-names>RZ</given-names>
						</name>
						<name>
							<surname>Aquino</surname>
							<given-names>LP</given-names>
						</name>
						<name>
							<surname>Alessi</surname>
							<given-names>AC</given-names>
						</name>
						<name>
							<surname>Costa</surname>
							<given-names>MT.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title>Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findings</article-title>
					<source>Veterinary Parasitology</source>
					<volume>1</volume>
					<issue>119</issue>
					<fpage>73</fpage>
					<lpage>86</lpage>
					<pub-id pub-id-type="doi">10.1016/j.vetpar.2003.10.012</pub-id>
				</element-citation>
			</ref>
			<ref id="B11">
				<mixed-citation>CDC (Center for Disease Control and Prevention). 2017. Rickettsial (spotted &amp; typhus fevers) &amp; related infections, including Anaplasmosis &amp; Ehrlichiosis. <ext-link ext-link-type="uri" xlink:href="https://wwwnc.cdc.gov/travel/yellowbook/2018/infectious-diseases-related-to-travel/Rickettsial-spotted-and-typhus-fevers-and-related-infections-including-anaplasmosis-and-ehrlichiosis#5251">https://wwwnc.cdc.gov/travel/yellowbook/2018/infectious-diseases-related-to-travel/Rickettsial-spotted-and-typhus-fevers-and-related-infections-including-anaplasmosis-and-ehrlichiosis#5251</ext-link>.</mixed-citation>
				<element-citation publication-type="webpage">
					<person-group person-group-type="author">
						<collab>CDC (Center for Disease Control and Prevention)</collab>
					</person-group>
					<year>2017</year>
					<source>Rickettsial (spotted &amp; typhus fevers) &amp; related infections, including Anaplasmosis &amp; Ehrlichiosis</source>
					<ext-link ext-link-type="uri" xlink:href="https://wwwnc.cdc.gov/travel/yellowbook/2018/infectious-diseases-related-to-travel/Rickettsial-spotted-and-typhus-fevers-and-related-infections-including-anaplasmosis-and-ehrlichiosis#5251">https://wwwnc.cdc.gov/travel/yellowbook/2018/infectious-diseases-related-to-travel/Rickettsial-spotted-and-typhus-fevers-and-related-infections-including-anaplasmosis-and-ehrlichiosis#5251</ext-link>
				</element-citation>
			</ref>
			<ref id="B12">
				<mixed-citation>Cicuttin G, Vidal P. De Salvo M, Beltrán F, Gury F. 2014. Detección molecular de <italic>Rickettsia massiliae</italic> y <italic>Anaplasma platys</italic> en garrapatas <italic>Rhipicephalus sanguineus</italic> y caninos domésticos del municipio de Bahía Blanca (Argentina). <italic>Revista chilena de infectología</italic>. 31(5):563-568. ISSN: 0716-1018. https://dx.doi.org/10.4067/S0716-10182014000500008</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cicuttin</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Vidal</surname>
							<given-names>P.</given-names>
						</name>
						<name>
							<surname>De Salvo</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Beltrán</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Gury</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Detección molecular de Rickettsia massiliae y Anaplasma platys en garrapatas Rhipicephalus sanguineus y caninos domésticos del municipio de Bahía Blanca (Argentina)</article-title>
					<source>Revista chilena de infectología</source>
					<volume>31</volume>
					<issue>5</issue>
					<fpage>563</fpage>
					<lpage>568</lpage>
					<issn>0716-1018</issn>
					<pub-id pub-id-type="doi">10.4067/S0716-10182014000500008</pub-id>
				</element-citation>
			</ref>
			<ref id="B13">
				<mixed-citation>Cicuttin G, De Salvo M.N , Gury FE. 2016. Molecular characterization of <italic>Ehrlichia canis</italic> infecting dogs, Buenos Aires. <italic>Ticks Tick Borne Dis</italic>. 7(5):954-957. https://doi.org/10.1016/j.ttbdis.2016.04.017</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cicuttin</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>De Salvo</surname>
							<given-names>M.N</given-names>
						</name>
						<name>
							<surname>Gury</surname>
							<given-names>FE.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Molecular characterization of Ehrlichia canis infecting dogs, Buenos Aires</article-title>
					<source>Ticks Tick Borne Dis</source>
					<volume>7</volume>
					<issue>5</issue>
					<fpage>954</fpage>
					<lpage>957</lpage>
					<pub-id pub-id-type="doi">10.1016/j.ttbdis.2016.04.017</pub-id>
				</element-citation>
			</ref>
			<ref id="B14">
				<mixed-citation>Díaz OC, Bolio ME, Rodríguez RI, Gutiérrez EJ, Pérez C. 2016. Estudio molecular de <italic>Ehrlichia canis</italic> en perros de México: prevalencia de infección y posibles factores asociados. <italic>Ecosistemas y recursos agropecuarios</italic>. 3(8):251-257. <ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.mx/pdf/era/v3n8/2007-901X-era-3-08-00251.pdf">http://www.scielo.org.mx/pdf/era/v3n8/2007-901X-era-3-08-00251.pdf</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Díaz</surname>
							<given-names>OC</given-names>
						</name>
						<name>
							<surname>Bolio</surname>
							<given-names>ME</given-names>
						</name>
						<name>
							<surname>Rodríguez</surname>
							<given-names>RI</given-names>
						</name>
						<name>
							<surname>Gutiérrez</surname>
							<given-names>EJ</given-names>
						</name>
						<name>
							<surname>Pérez</surname>
							<given-names>C.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Estudio molecular de Ehrlichia canis en perros de México: prevalencia de infección y posibles factores asociados</article-title>
					<source>Ecosistemas y recursos agropecuarios</source>
					<volume>3</volume>
					<issue>8</issue>
					<fpage>251</fpage>
					<lpage>257</lpage>
					<ext-link ext-link-type="uri" xlink:href="http://www.scielo.org.mx/pdf/era/v3n8/2007-901X-era-3-08-00251.pdf">http://www.scielo.org.mx/pdf/era/v3n8/2007-901X-era-3-08-00251.pdf</ext-link>
				</element-citation>
			</ref>
			<ref id="B15">
				<mixed-citation>Escárcega AM, Luna BS, Mora A DL, Jiménez F. 2018. Análisis exploratorio de enfermedades <italic>Rickettsiales</italic> transmitidas por garrapatas en perros de Ciudad Juárez, Chihuahua, México. <italic>Acta Universitaria</italic>. 28(3):72-78. https://doi.org/10.15174/au.2018.1678</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Escárcega</surname>
							<given-names>AM</given-names>
						</name>
						<name>
							<surname>Luna</surname>
							<given-names>BS</given-names>
						</name>
						<name>
							<surname>Mora A</surname>
							<given-names>DL</given-names>
						</name>
						<name>
							<surname>Jiménez</surname>
							<given-names>F.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>Análisis exploratorio de enfermedades Rickettsiales transmitidas por garrapatas en perros de Ciudad Juárez, Chihuahua, México</article-title>
					<source>Acta Universitaria</source>
					<volume>28</volume>
					<issue>3</issue>
					<fpage>72</fpage>
					<lpage>78</lpage>
					<pub-id pub-id-type="doi">10.15174/au.2018.1678</pub-id>
				</element-citation>
			</ref>
			<ref id="B16">
				<mixed-citation>Foley J, Tinoco L, Rodriguez M, Estrada J, Fierro M, Mattar E, Peterson A, Pascoe E, Gonzalez Y, Hori S, Armstrong PA, Lopez G, Jacome M, Paddock CD, Zazueta OE. 2019. Unbiased assessment of abundance of <italic>Rhipicephalus sanguineus sensu lato</italic> ticks, canine exposure to spotted fever group rickettsia, and risk factors in Mexicali, Mexico. <italic>The American Journal of Tropical Medicine and Hygiene</italic>. 101(1):22-32. ISSN: 0002-9637. https://doi.org/10.4269/ajtmh.18-0878</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Foley</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Tinoco</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Rodriguez</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Estrada</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Fierro</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Mattar</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Peterson</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Pascoe</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Gonzalez</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Hori</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Armstrong</surname>
							<given-names>PA</given-names>
						</name>
						<name>
							<surname>Lopez</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Jacome</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Paddock</surname>
							<given-names>CD</given-names>
						</name>
						<name>
							<surname>Zazueta</surname>
							<given-names>OE.</given-names>
						</name>
					</person-group>
					<year>2019</year>
					<article-title>Unbiased assessment of abundance of Rhipicephalus sanguineus sensu lato ticks, canine exposure to spotted fever group rickettsia, and risk factors in Mexicali, Mexico</article-title>
					<source>The American Journal of Tropical Medicine and Hygiene</source>
					<volume>101</volume>
					<issue>1</issue>
					<fpage>22</fpage>
					<lpage>32</lpage>
					<issn>0002-9637</issn>
					<pub-id pub-id-type="doi">10.4269/ajtmh.18-0878</pub-id>
				</element-citation>
			</ref>
			<ref id="B17">
				<mixed-citation>Gaunt S, Beall MJ, Stillman BA, Lorentzen L, Diniz PPVP, Chandrashekar R, Breitschwerdt EB. 2010. Experimental infection and co-infection of dogs with <italic>Anaplasma platy and Ehrlichia canis</italic>: hematologic, serologic and molecular findings. <italic>Parasites &amp; Vectors</italic>. 3(33). ISSN: 1756-3305. https://doi.org/10.1186/1756-3305-3-33</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gaunt</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Beall</surname>
							<given-names>MJ</given-names>
						</name>
						<name>
							<surname>Stillman</surname>
							<given-names>BA</given-names>
						</name>
						<name>
							<surname>Lorentzen</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Diniz</surname>
							<given-names>PPVP</given-names>
						</name>
						<name>
							<surname>Chandrashekar</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Breitschwerdt</surname>
							<given-names>EB.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Experimental infection and co-infection of dogs with Anaplasma platy and Ehrlichia canis: hematologic, serologic and molecular findings</article-title>
					<source>Parasites &amp; Vectors</source>
					<volume>3</volume>
					<issue>33</issue>
					<issn>1756-3305</issn>
					<pub-id pub-id-type="doi">10.1186/1756-3305-3-33</pub-id>
				</element-citation>
			</ref>
			<ref id="B18">
				<mixed-citation>Gutiérrez CN, Pérez L, Agrela IF. 2016. Ehrlichiosis canina, Universidad de Carabobo. <italic>Saber</italic>. 28(4):641-665. <ext-link ext-link-type="uri" xlink:href="http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S131501622016000400002&amp;lng=e s&amp;tlng=en">http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S131501622016000400002&amp;lng=e s&amp;tlng=en</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gutiérrez</surname>
							<given-names>CN</given-names>
						</name>
						<name>
							<surname>Pérez</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Agrela</surname>
							<given-names>IF.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Ehrlichiosis canina, Universidad de Carabobo</article-title>
					<source>Saber</source>
					<volume>28</volume>
					<issue>4</issue>
					<fpage>641</fpage>
					<lpage>665</lpage>
					<ext-link ext-link-type="uri" xlink:href="http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S131501622016000400002&amp;lng=e s&amp;tlng=en">http://ve.scielo.org/scielo.php?script=sci_arttext&amp;pid=S131501622016000400002&amp;lng=e s&amp;tlng=en</ext-link>
				</element-citation>
			</ref>
			<ref id="B19">
				<mixed-citation>Herrero JA, García E, Hernández Gómez, J. 2010. Infecciones por rickettsias y fiebre Q. <italic>Medicine Programa de Formación Médica Continuada Acreditado</italic>. 10(57):3881-3888. https://doi.org/10.1016/S0304-5412(10)70131-1</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Herrero</surname>
							<given-names>JA</given-names>
						</name>
						<name>
							<surname>García</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Hernández Gómez</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Infecciones por rickettsias y fiebre Q</article-title>
					<source>Medicine Programa de Formación Médica Continuada Acreditado</source>
					<volume>10</volume>
					<issue>57</issue>
					<fpage>3881</fpage>
					<lpage>3888</lpage>
					<pub-id pub-id-type="doi">10.1016/S0304-5412(10)70131-1</pub-id>
				</element-citation>
			</ref>
			<ref id="B20">
				<mixed-citation>Ismail N, Bloch KC, McBride JW. 2010. Human ehrlichiosis and anaplasmosis. <italic>Clinics in Laboratory Medicine</italic>. 30(1):261-292. ISSN: 0272-2712. https://doi.org/10.1016/j.cll.2009.10.004</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ismail</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Bloch</surname>
							<given-names>KC</given-names>
						</name>
						<name>
							<surname>McBride</surname>
							<given-names>JW.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Human ehrlichiosis and anaplasmosis</article-title>
					<source>Clinics in Laboratory Medicine</source>
					<volume>30</volume>
					<issue>1</issue>
					<fpage>261</fpage>
					<lpage>292</lpage>
					<issn>0272-2712</issn>
					<pub-id pub-id-type="doi">10.1016/j.cll.2009.10.004</pub-id>
				</element-citation>
			</ref>
			<ref id="B21">
				<mixed-citation>Krüttgen A, Razavi, S, Imöhl, M. 2011. Real-time PCR assay and a synthetic positive control for the rapid and sensitive detection of the emerging resistance gene New Delhi Metallo-β-lactamase-1 (bla NDM-1). <italic>Medical Microbiology and Immunology</italic>. 200(1):137- 141. ISSN: 1432-1831. https://doi.org/10.1007/s00430-011-0189-y</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Krüttgen</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Razavi</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Imöhl</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2011</year>
					<article-title>Real-time PCR assay and a synthetic positive control for the rapid and sensitive detection of the emerging resistance gene New Delhi Metallo-β-lactamase-1 (bla NDM-1)</article-title>
					<source>Medical Microbiology and Immunology</source>
					<volume>200</volume>
					<issue>1</issue>
					<fpage>137</fpage>
					<lpage> 141</lpage>
					<issn>1432-1831</issn>
					<pub-id pub-id-type="doi">10.1007/s00430-011-0189-y</pub-id>
				</element-citation>
			</ref>
			<ref id="B22">
				<mixed-citation>Labruna MB. 2009. Ecology of rickettsia in South America. <italic>Ann NY Acad Sci</italic>. 1166(1): 156-166. https://doi.org/10.1111/j.1749-6632.2009.04516.x</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Labruna</surname>
							<given-names>MB.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Ecology of rickettsia in South America</article-title>
					<source>Ann NY Acad Sci</source>
					<volume>1166</volume>
					<issue>1</issue>
					<fpage>156</fpage>
					<lpage>166</lpage>
					<pub-id pub-id-type="doi">10.1111/j.1749-6632.2009.04516.x</pub-id>
				</element-citation>
			</ref>
			<ref id="B23">
				<mixed-citation>Lebruna MB, Mattar VS, Nava S, Bermudez M, Venzal JM, Dolz G, Abarca K, Romero L, Sousa R, Oteo J and Zavala CJ. 2011. Rickettsioses in Latin America, Caribbean, Spain and Portugal. <italic>Revista MVZ Córdoba</italic>. 16(2):2435-2457. ISNN-L: 0122-0268. https://doi.org/10.21897/rmvz.282</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lebruna</surname>
							<given-names>MB</given-names>
						</name>
						<name>
							<surname>Mattar</surname>
							<given-names>VS</given-names>
						</name>
						<name>
							<surname>Nava</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Bermudez</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Venzal</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Dolz</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Abarca</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Romero</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Sousa</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Oteo</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Zavala</surname>
							<given-names>CJ.</given-names>
						</name>
					</person-group>
					<year>2011</year>
					<article-title>Rickettsioses in Latin America, Caribbean, Spain and Portugal</article-title>
					<source>Revista MVZ Córdoba</source>
					<volume>16</volume>
					<issue>2</issue>
					<fpage>2435</fpage>
					<lpage>2457</lpage>
					<issn>0122-0268</issn>
					<pub-id pub-id-type="doi">10.21897/rmvz.282</pub-id>
				</element-citation>
			</ref>
			<ref id="B24">
				<mixed-citation>López PJ, Abarca VK, Azócar AT. 2007. Evidencia clínica y serológica de Rickettsiosis canina en Chile. <italic>Revista chilena de infectología</italic>. 24(3):189-193. ISSN: 0716-1018. https://doi.org/10.4067/s0716-10182007000300002</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>López</surname>
							<given-names>PJ</given-names>
						</name>
						<name>
							<surname>Abarca</surname>
							<given-names>VK</given-names>
						</name>
						<name>
							<surname>Azócar</surname>
							<given-names>AT.</given-names>
						</name>
					</person-group>
					<year>2007</year>
					<article-title>Evidencia clínica y serológica de Rickettsiosis canina en Chile</article-title>
					<source>Revista chilena de infectología</source>
					<volume>24</volume>
					<issue>3</issue>
					<fpage>189</fpage>
					<lpage>193</lpage>
					<issn>0716-1018</issn>
					<pub-id pub-id-type="doi">10.4067/s0716-10182007000300002</pub-id>
				</element-citation>
			</ref>
			<ref id="B25">
				<mixed-citation>Miranda RE, Najarro RA, Navarrete IV. 2018. Detección molecular de Anaplasma platys, Babesia spp., <italic>Ehrlichia canis</italic> y <italic>Hepatozoon canis</italic> en caninos (<italic>Canis lupus familiaris</italic>) con sospecha de hemoparásitos en clínicas veterinarias de Santa Tecla y San Salvador, El Salvador. (<italic>Doctoral dissertation, Universidad de El Salvador</italic>). <ext-link ext-link-type="uri" xlink:href="http://ri.ues.edu.sv/id/eprint/16493/">http://ri.ues.edu.sv/id/eprint/16493/</ext-link>
				</mixed-citation>
				<element-citation publication-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Miranda</surname>
							<given-names>RE</given-names>
						</name>
						<name>
							<surname>Najarro</surname>
							<given-names>RA</given-names>
						</name>
						<name>
							<surname>Navarrete</surname>
							<given-names>IV.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<source>Detección molecular de Anaplasma platys, Babesia spp., <italic>Ehrlichia canis</italic> y <italic>Hepatozoon canis</italic> en caninos (<italic>Canis lupus familiaris</italic>) con sospecha de hemoparásitos en clínicas veterinarias de Santa Tecla y San Salvador, El Salvador</source>
					<publisher-name>Doctoral dissertation, Universidad de El Salvador</publisher-name>
					<ext-link ext-link-type="uri" xlink:href="http://ri.ues.edu.sv/id/eprint/16493/">http://ri.ues.edu.sv/id/eprint/16493/</ext-link>
				</element-citation>
			</ref>
			<ref id="B26">
				<mixed-citation>Murrieta ZZ, Tinoco L, Hori S, López G, Tamayo AL, Barreras A. 2017. Identificación molecular de especies de los géneros <italic>Ehrlichia</italic> y <italic>Anaplasma</italic> en perros de la ciudad de San Luis Río Colorado, Sonora, México. <italic>VIII</italic> 
 <italic>Congreso Internacional COMVEPE BC-IICV- UABC de Medicina Veterinaria en Pequeñas Especies Mexicali, B.C</italic>. <ext-link ext-link-type="uri" xlink:href="https://docplayer.es/65503949-Identificacion-molecular-de-especies-de-los-generos ehrlichia-y-anaplasma-en-perros-de-la-ciudad-de-san-luis-rio-colorado-sonora- mexico.html">https://docplayer.es/65503949-Identificacion-molecular-de-especies-de-los-generos ehrlichia-y-anaplasma-en-perros-de-la-ciudad-de-san-luis-rio-colorado-sonora- mexico.html</ext-link>
				</mixed-citation>
				<element-citation publication-type="confproc">
					<person-group person-group-type="author">
						<name>
							<surname>Murrieta</surname>
							<given-names>ZZ</given-names>
						</name>
						<name>
							<surname>Tinoco</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Hori</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>López</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Tamayo</surname>
							<given-names>AL</given-names>
						</name>
						<name>
							<surname>Barreras</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<source>Identificación molecular de especies de los géneros <italic>Ehrlichia</italic> y <italic>Anaplasma</italic> en perros de la ciudad de San Luis Río Colorado, Sonora, México</source>
					<conf-name>VIIICongreso Internacional COMVEPE BC-IICV- UABC de Medicina Veterinaria en Pequeñas Especies Mexicali, B.C</conf-name>
					<ext-link ext-link-type="uri" xlink:href="https://docplayer.es/65503949-Identificacion-molecular-de-especies-de-los-generos ehrlichia-y-anaplasma-en-perros-de-la-ciudad-de-san-luis-rio-colorado-sonora- mexico.html">https://docplayer.es/65503949-Identificacion-molecular-de-especies-de-los-generos ehrlichia-y-anaplasma-en-perros-de-la-ciudad-de-san-luis-rio-colorado-sonora- mexico.html</ext-link>
				</element-citation>
			</ref>
			<ref id="B27">
				<mixed-citation>Oteo JA, Nava S, Sousa R, Mattar S, Venzal J M, Abarca K, Labruna MB, Zavala J. 2014. Guías Latinoamericanas de la RIICER para el diagnóstico de las <italic>Rickettsiosis</italic> transmitidas por garrapatas. <italic>Revista chilena de infectología</italic>. 31(1):54-65. ISSN: 0716-1018. https://doi.org/10.4067/s0716-10182014000100009</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Oteo</surname>
							<given-names>JA</given-names>
						</name>
						<name>
							<surname>Nava</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Sousa</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Mattar</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Venzal</surname>
							<given-names>J M</given-names>
						</name>
						<name>
							<surname>Abarca</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Labruna</surname>
							<given-names>MB</given-names>
						</name>
						<name>
							<surname>Zavala</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Guías Latinoamericanas de la RIICER para el diagnóstico de las Rickettsiosis transmitidas por garrapatas</article-title>
					<source>Revista chilena de infectología</source>
					<volume>31</volume>
					<issue>1</issue>
					<fpage>54</fpage>
					<lpage>65</lpage>
					<issn>0716-1018</issn>
					<pub-id pub-id-type="doi">10.4067/s0716-10182014000100009</pub-id>
				</element-citation>
			</ref>
			<ref id="B28">
				<mixed-citation>Pat H, Rodriguez RI, Bolio ME, Villegas SL, Reyes E. 2015. Molecular Diagnosis of Ehrlichia canis in Dogs and Ticks <italic>Rhipicephalus sanguineus</italic> (Acari: Ixodidae) in Yucatan, Mexico. <italic>Journal of Medical Entomology</italic>. 52(1):101-104. https://doi.org/10.1093/jme/tju010</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pat</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Rodriguez</surname>
							<given-names>RI</given-names>
						</name>
						<name>
							<surname>Bolio</surname>
							<given-names>ME</given-names>
						</name>
						<name>
							<surname>Villegas</surname>
							<given-names>SL</given-names>
						</name>
						<name>
							<surname>Reyes</surname>
							<given-names>E.</given-names>
						</name>
					</person-group>
					<year>2015</year>
					<article-title>Molecular Diagnosis of Ehrlichia canis in Dogs and Ticks Rhipicephalus sanguineus (Acari: Ixodidae) in Yucatan, Mexico</article-title>
					<source>Journal of Medical Entomology</source>
					<volume>52</volume>
					<issue>1</issue>
					<fpage>101</fpage>
					<lpage>104</lpage>
					<pub-id pub-id-type="doi">10.1093/jme/tju010</pub-id>
				</element-citation>
			</ref>
			<ref id="B29">
				<mixed-citation>Parola P, Rovery C, Rolain JM, Brouqui P, Davoust B, Raoult D. 2009. <italic>Rickettsia slovaca</italic> and <italic>R. raoultii</italic> in Tick-borne Rickettsioses. <italic>Emerging Infectious Diseases</italic>. 15(7):1105-1108. ISSN: 1080-6059. https://doi.org/10.3201/eid1507.081449</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Parola</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Rovery</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Rolain</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Brouqui</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Davoust</surname>
							<given-names>B</given-names>
						</name>
						<name>
							<surname>Raoult</surname>
							<given-names>D.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Rickettsia slovaca and R. raoultii in Tick-borne Rickettsioses</article-title>
					<source>Emerging Infectious Diseases</source>
					<volume>15</volume>
					<issue>7</issue>
					<fpage>1105</fpage>
					<lpage>1108</lpage>
					<issn>1080-6059</issn>
					<pub-id pub-id-type="doi">10.3201/eid1507.081449</pub-id>
				</element-citation>
			</ref>
			<ref id="B30">
				<mixed-citation>Peniche LG, Pérez OC, Dzul RK, Zavala CJ. 2015. Rickettsiosis: Enfermedad Re- Emergente en México. <italic>Ciencia y Humanismo en la salud</italic>. 2(2):76-84. ISSN: 2395-8707. <ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/profile/KarlaRossanet/publication/332707900_Rickettsiosis_Enfermedades_ReEmergente_en_Mexico/links/5cc5446da6fdcc1d49b47593/Rickettsiosis-Enfermedades-Re-Emergente-en-Mexico.pdf">https://www.researchgate.net/profile/KarlaRossanet/publication/332707900_Rickettsiosis_Enfermedades_ReEmergente_en_Mexico/links/5cc5446da6fdcc1d49b47593/Rickettsiosis-Enfermedades-Re-Emergente-en-Mexico.pdf</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Peniche</surname>
							<given-names>LG</given-names>
						</name>
						<name>
							<surname>Pérez</surname>
							<given-names>OC</given-names>
						</name>
						<name>
							<surname>Dzul</surname>
							<given-names>RK</given-names>
						</name>
						<name>
							<surname>Zavala</surname>
							<given-names>CJ.</given-names>
						</name>
					</person-group>
					<year>2015</year>
					<article-title>Rickettsiosis: Enfermedad Re- Emergente en México</article-title>
					<source>Ciencia y Humanismo en la salud</source>
					<volume>2</volume>
					<issue>2</issue>
					<fpage>76</fpage>
					<lpage>84</lpage>
					<issn>2395-8707</issn>
					<ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/profile/KarlaRossanet/publication/332707900_Rickettsiosis_Enfermedades_ReEmergente_en_Mexico/links/5cc5446da6fdcc1d49b47593/Rickettsiosis-Enfermedades-Re-Emergente-en-Mexico.pdf">https://www.researchgate.net/profile/KarlaRossanet/publication/332707900_Rickettsiosis_Enfermedades_ReEmergente_en_Mexico/links/5cc5446da6fdcc1d49b47593/Rickettsiosis-Enfermedades-Re-Emergente-en-Mexico.pdf</ext-link>
				</element-citation>
			</ref>
			<ref id="B31">
				<mixed-citation>Programa Sectorial DE Salud (PSS). 2014. Prevención y Control de las Rickettsiosis. <italic>Programa de Acción Específico</italic>. México. <ext-link ext-link-type="uri" xlink:href="http://www.cenaprece.salud.gob.mx/descargas/pdf/PAE_PrevencionControlRickettsiosis 2013_2018.pdf">http://www.cenaprece.salud.gob.mx/descargas/pdf/PAE_PrevencionControlRickettsiosis 2013_2018.pdf</ext-link>
				</mixed-citation>
				<element-citation publication-type="webpage">
					<person-group person-group-type="author">
						<collab>Programa Sectorial DE Salud (PSS)</collab>
					</person-group>
					<year>2014</year>
					<source>Prevención y Control de las Rickettsiosis. <italic>Programa de Acción Específico</italic></source>
					<publisher-name>México</publisher-name>
					<ext-link ext-link-type="uri" xlink:href="http://www.cenaprece.salud.gob.mx/descargas/pdf/PAE_PrevencionControlRickettsiosis 2013_2018.pdf">http://www.cenaprece.salud.gob.mx/descargas/pdf/PAE_PrevencionControlRickettsiosis 2013_2018.pdf</ext-link>
				</element-citation>
			</ref>
			<ref id="B32">
				<mixed-citation>Rodríguez RI, Apanaskevich DA, Ojeda-Chi MM, Trinidad I, Reyes E, Esteve MD, Pérez AA. 2016. Ticks collected from humans, domestic animals, and wildlife in Yucatan, Mexico. <italic>Veterinary Parasitology</italic>. 215:106-113. https://doi.org/10.1016/j.vetpar.2015.11.010</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rodríguez</surname>
							<given-names>RI</given-names>
						</name>
						<name>
							<surname>Apanaskevich</surname>
							<given-names>DA</given-names>
						</name>
						<name>
							<surname>Ojeda-Chi</surname>
							<given-names>MM</given-names>
						</name>
						<name>
							<surname>Trinidad</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Reyes</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Esteve</surname>
							<given-names>MD</given-names>
						</name>
						<name>
							<surname>Pérez</surname>
							<given-names>AA.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Ticks collected from humans, domestic animals, and wildlife in Yucatan, Mexico</article-title>
					<source>Veterinary Parasitology</source>
					<volume>215</volume>
					<fpage>106</fpage>
					<lpage>113</lpage>
					<pub-id pub-id-type="doi">10.1016/j.vetpar.2015.11.010</pub-id>
				</element-citation>
			</ref>
			<ref id="B33">
				<mixed-citation>Rojas A, Rojas D, Montenegro D, Gutiérrez R, Yasur-Landau D, Baneth G. 2014. Vector-borne pathogens in dogs from Costa Rica: First molecular description of <italic>Babesia vogeli</italic> and <italic>Hepatozoon canis</italic> infections with a high prevalence of monocytic <italic>ehrlichiosis</italic> and the manifestations of co-infection. <italic>Veterinary parasitology</italic>. 199(3-4):121-128. https://doi.org/10.1016/j.vetpar.2013.10.027</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rojas</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Rojas</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Montenegro</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Gutiérrez</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Yasur-Landau</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Baneth</surname>
							<given-names>G.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Vector-borne pathogens in dogs from Costa Rica: First molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection</article-title>
					<source>Veterinary parasitology</source>
					<volume>199</volume>
					<issue>3-4</issue>
					<fpage>121</fpage>
					<lpage>128</lpage>
					<pub-id pub-id-type="doi">10.1016/j.vetpar.2013.10.027</pub-id>
				</element-citation>
			</ref>
			<ref id="B34">
				<mixed-citation>Rojas A, Rueda A, Díaz D, Mesa NC, Benavides JA, Imbachi K, López R. 2013. Identificación de <italic>Ehrlichia canis</italic> (Donatien &amp; Lestoquard) Moshkovski mediante PCR anidada. <italic>Veterinaria y Zootecnía</italic>. 7(1):37-48. <ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/profile/Javier_Benavides_Montano/publication/314533462_Identificacion_de_Ehrlichia_canis_Donatien_Lestoquard_Moshkovski_mediante_PCR_anidada/links/58c322b892851c0ccbf14401/Identificacion-de-Ehrlichia-canis-Donatien-Lestoquard-Moshkovski-mediante-PCR-anidada.pdf">https://www.researchgate.net/profile/Javier_Benavides_Montano/publication/314533462_Identificacion_de_Ehrlichia_canis_Donatien_Lestoquard_Moshkovski_mediante_PCR_anidada/links/58c322b892851c0ccbf14401/Identificacion-de-Ehrlichia-canis-Donatien-Lestoquard-Moshkovski-mediante-PCR-anidada.pdf</ext-link>
				</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Rojas</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Rueda</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Díaz</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Mesa</surname>
							<given-names>NC</given-names>
						</name>
						<name>
							<surname>Benavides</surname>
							<given-names>JA</given-names>
						</name>
						<name>
							<surname>Imbachi</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>López</surname>
							<given-names>R.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Identificación de Ehrlichia canis (Donatien &amp; Lestoquard) Moshkovski mediante PCR anidada</article-title>
					<source>Veterinaria y Zootecnía</source>
					<volume>7</volume>
					<issue>1</issue>
					<fpage>37</fpage>
					<lpage>48</lpage>
					<ext-link ext-link-type="uri" xlink:href="https://www.researchgate.net/profile/Javier_Benavides_Montano/publication/314533462_Identificacion_de_Ehrlichia_canis_Donatien_Lestoquard_Moshkovski_mediante_PCR_anidada/links/58c322b892851c0ccbf14401/Identificacion-de-Ehrlichia-canis-Donatien-Lestoquard-Moshkovski-mediante-PCR-anidada.pdf">https://www.researchgate.net/profile/Javier_Benavides_Montano/publication/314533462_Identificacion_de_Ehrlichia_canis_Donatien_Lestoquard_Moshkovski_mediante_PCR_anidada/links/58c322b892851c0ccbf14401/Identificacion-de-Ehrlichia-canis-Donatien-Lestoquard-Moshkovski-mediante-PCR-anidada.pdf</ext-link>
				</element-citation>
			</ref>
			<ref id="B35">
				<mixed-citation>Sánchez G, Tesouro M. 2001. <italic>Ehrlichiosis</italic>. <italic>Canis et felis</italic>. 51. ISSN: 1133-2751. <ext-link ext-link-type="uri" xlink:href="https://agris.fao.org/agris-search/search.do?recordID=ES20020018360">https://agris.fao.org/agris-search/search.do?recordID=ES20020018360</ext-link>
				</mixed-citation>
				<element-citation publication-type="webpage">
					<person-group person-group-type="author">
						<name>
							<surname>Sánchez</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Tesouro</surname>
							<given-names>M.</given-names>
						</name>
					</person-group>
					<year>2001</year>
					<source>Ehrlichiosis. Canis et felis</source>
					<volume>51</volume>
					<issn>1133-2751</issn>
					<ext-link ext-link-type="uri" xlink:href="https://agris.fao.org/agris-search/search.do?recordID=ES20020018360">https://agris.fao.org/agris-search/search.do?recordID=ES20020018360</ext-link>
				</element-citation>
			</ref>
			<ref id="B36">
				<mixed-citation>Santamaria A, Calzada J, Saldaña A, Yabsley M, Gottdenker N. 2014. Molecular diagnosis and species identification of <italic>Ehrlichia</italic> and <italic>Anaplasma</italic> infections in dogs from Panama, Central Americ. <italic>Vector Borne Zoonotic Dis</italic>. 14(5):368-370. https://doi.org/10.1089/vbz.2013.1488</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Santamaria</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Calzada</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Saldaña</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Yabsley</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Gottdenker</surname>
							<given-names>N.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Molecular diagnosis and species identification of Ehrlichia and Anaplasma infections in dogs from Panama, Central Americ</article-title>
					<source>Vector Borne Zoonotic Dis</source>
					<volume>14</volume>
					<issue>5</issue>
					<fpage>368</fpage>
					<lpage>370</lpage>
					<pub-id pub-id-type="doi">10.1089/vbz.2013.1488</pub-id>
				</element-citation>
			</ref>
			<ref id="B37">
				<mixed-citation>Silva CB, Santos HA, Navarrete MG, Ribeiro DU, Gonzalez BC, Zaldivar MF, Pires MS, Peckle M, Costa LD, Vitari LV, Massard CL. 2016. Molecular detection and characterization of <italic>Anaplasma platys</italic> in dogs and ticks in Cuba. <italic>Ticks and Tick-borne Diseases</italic>. 7(5):938-944. https://doi.org/10.1016/j.ttbdis.2016.04.012</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Silva</surname>
							<given-names>CB</given-names>
						</name>
						<name>
							<surname>Santos</surname>
							<given-names>HA</given-names>
						</name>
						<name>
							<surname>Navarrete</surname>
							<given-names>MG</given-names>
						</name>
						<name>
							<surname>Ribeiro</surname>
							<given-names>DU</given-names>
						</name>
						<name>
							<surname>Gonzalez</surname>
							<given-names>BC</given-names>
						</name>
						<name>
							<surname>Zaldivar</surname>
							<given-names>MF</given-names>
						</name>
						<name>
							<surname>Pires</surname>
							<given-names>MS</given-names>
						</name>
						<name>
							<surname>Peckle</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Costa</surname>
							<given-names>LD</given-names>
						</name>
						<name>
							<surname>Vitari</surname>
							<given-names>LV</given-names>
						</name>
						<name>
							<surname>Massard</surname>
							<given-names>CL.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Molecular detection and characterization of Anaplasma platys in dogs and ticks in Cuba</article-title>
					<source>Ticks and Tick-borne Diseases</source>
					<volume>7</volume>
					<issue>5</issue>
					<fpage>938</fpage>
					<lpage>944</lpage>
					<pub-id pub-id-type="doi">10.1016/j.ttbdis.2016.04.012</pub-id>
				</element-citation>
			</ref>
			<ref id="B38">
				<mixed-citation>Silva JN, Almeida A B, Boa E C. 2010. Seroprevalence anti-<italic>Ehrlichia canis</italic> antibodies in dogs of Cuiabá, Mato Grosso. <italic>Brazilian Journal of Veterinary Parasitology</italic>. 19(2):108-111. https://doi.org/10.4322/rbpv.01902008</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Silva</surname>
							<given-names>JN</given-names>
						</name>
						<name>
							<surname>Almeida</surname>
							<given-names>A B</given-names>
						</name>
						<name>
							<surname>Boa</surname>
							<given-names>E C.</given-names>
						</name>
					</person-group>
					<year>2010</year>
					<article-title>Seroprevalence anti-Ehrlichia canis antibodies in dogs of Cuiabá, Mato Grosso</article-title>
					<source>Brazilian Journal of Veterinary Parasitology</source>
					<volume>19</volume>
					<issue>2</issue>
					<fpage>108</fpage>
					<lpage>111</lpage>
					<pub-id pub-id-type="doi">10.4322/rbpv.01902008</pub-id>
				</element-citation>
			</ref>
			<ref id="B39">
				<mixed-citation>Sosa, CG, Quintero MT, Gaxiola SM, Cota S, Esteve MD, Gordillo MG. 2013. Frequency and clinical epidemiology of canine monocytic <italic>ehrlichiosis</italic> in dogs infested with ticks from Sinaloa, Mexico. <italic>Journal of Veterinary Medicine</italic>. https://doi.org/10.1155/2013/797019</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Sosa</surname>
							<given-names>CG</given-names>
						</name>
						<name>
							<surname>Quintero</surname>
							<given-names>MT</given-names>
						</name>
						<name>
							<surname>Gaxiola</surname>
							<given-names>SM</given-names>
						</name>
						<name>
							<surname>Cota</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Esteve</surname>
							<given-names>MD</given-names>
						</name>
						<name>
							<surname>Gordillo</surname>
							<given-names>MG.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Frequency and clinical epidemiology of canine monocytic ehrlichiosis in dogs infested with ticks from Sinaloa, Mexico</article-title>
					<source>Journal of Veterinary Medicine</source>
					<pub-id pub-id-type="doi">10.1155/2013/797019</pub-id>
				</element-citation>
			</ref>
			<ref id="B40">
				<mixed-citation>Sosa CG, Quintero T, Vargas M, Gordillo P. 2016. Primer análisis filogenético de <italic>Ehrlichia canis</italic> en perros y garrapatas de México. Estudio preliminar. <italic>Revista MVZ Córdoba</italic>. 21(3):5569-5576. https://doi.org/10.21897/rmvz.831</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Sosa</surname>
							<given-names>CG</given-names>
						</name>
						<name>
							<surname>Quintero</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Vargas</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Gordillo</surname>
							<given-names>P.</given-names>
						</name>
					</person-group>
					<year>2016</year>
					<article-title>Primer análisis filogenético de Ehrlichia canis en perros y garrapatas de México. Estudio preliminar</article-title>
					<source>Revista MVZ Córdoba</source>
					<volume>21</volume>
					<issue>3</issue>
					<fpage>5569</fpage>
					<lpage>5576</lpage>
					<pub-id pub-id-type="doi">10.21897/rmvz.831</pub-id>
				</element-citation>
			</ref>
			<ref id="B41">
				<mixed-citation>Sutherst RW. 2004. Global change and human vulnerability to vector-borne diseases. <italic>Clin Microbiol Rev</italic>. 17(1):136-73. https://doi.org/10.1128/CMR.17.1.136- 173.2004</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Sutherst</surname>
							<given-names>RW.</given-names>
						</name>
					</person-group>
					<year>2004</year>
					<article-title>Global change and human vulnerability to vector-borne diseases</article-title>
					<source>Clin Microbiol Rev</source>
					<volume>17</volume>
					<issue>1</issue>
					<fpage>136</fpage>
					<lpage>173</lpage>
					<pub-id pub-id-type="doi">10.1128/CMR.17.1.136- 173.2004</pub-id>
				</element-citation>
			</ref>
			<ref id="B42">
				<mixed-citation>Tanikawa A, Labruna MB, Costa A. 2013. <italic>Ehrlichia canis</italic> in dogs in a semiarid región of Northeastern Brazil: Serology, molecular detection and associated factors. <italic>Res Vet Sci</italic>. 94(3):474-477. https://doi.org/10.1016/j.rvsc.2012.10.007</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Tanikawa</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Labruna</surname>
							<given-names>MB</given-names>
						</name>
						<name>
							<surname>Costa</surname>
							<given-names>A.</given-names>
						</name>
					</person-group>
					<year>2013</year>
					<article-title>Ehrlichia canis in dogs in a semiarid región of Northeastern Brazil: Serology, molecular detection and associated factors</article-title>
					<source>Res Vet Sci</source>
					<volume>94</volume>
					<issue>3</issue>
					<fpage>474</fpage>
					<lpage>477</lpage>
					<pub-id pub-id-type="doi">10.1016/j.rvsc.2012.10.007</pub-id>
				</element-citation>
			</ref>
			<ref id="B43">
				<mixed-citation>Tinoco GL, Lomelí MR, Hori S, Stephenson N, Foley J. 2018. Molecular confirmation of Rocky Mountain spotted fever epidemic agent in Mexicali, Mexico. <italic>Emerging Infectious Diseases</italic>, 24(9):1723-1725. https://doi.org/10.3201/eid2409.171523</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Tinoco</surname>
							<given-names>GL</given-names>
						</name>
						<name>
							<surname>Lomelí</surname>
							<given-names>MR</given-names>
						</name>
						<name>
							<surname>Hori</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Stephenson</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Foley</surname>
							<given-names>J.</given-names>
						</name>
					</person-group>
					<year>2018</year>
					<article-title>Molecular confirmation of Rocky Mountain spotted fever epidemic agent in Mexicali, Mexico</article-title>
					<source>Emerging Infectious Diseases</source>
					<volume>24</volume>
					<issue>9</issue>
					<fpage>1723</fpage>
					<lpage>1725</lpage>
					<pub-id pub-id-type="doi">10.3201/eid2409.171523</pub-id>
				</element-citation>
			</ref>
			<ref id="B44">
				<mixed-citation>Mutz I. 2009. Las infecciones emergentes transmitidas por garrapatas. <italic>Annales Nestlé</italic>. 67(3):123-134. ISSN: 0252-8185. https://doi.org/10.1159/000287275</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Mutz</surname>
							<given-names>I.</given-names>
						</name>
					</person-group>
					<year>2009</year>
					<article-title>Las infecciones emergentes transmitidas por garrapatas</article-title>
					<source>Annales Nestlé</source>
					<volume>67</volume>
					<issue>3</issue>
					<fpage>123</fpage>
					<lpage>134</lpage>
					<issn>0252-8185</issn>
					<pub-id pub-id-type="doi">10.1159/000287275</pub-id>
				</element-citation>
			</ref>
			<ref id="B45">
				<mixed-citation>Ng-Nguyen D, Stevenson MA, Dorny P, Gabriël S, Vo TV, Nguyen V-AT, Phan TV, Hii SF, Traub RJ. 2017. Comparison of a new multiplex real-time PCR withthe Kato Katzthick smear and copro-antigen ELISA for the detection and differentiation of <italic>Taenia spp.</italic> in human stools. <italic>PLoS Negl Trop Dis</italic>. 11(7):e0005743. https://doi.org/10.1371/journal.pntd.0005743</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ng-Nguyen</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Stevenson</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Dorny</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Gabriël</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Vo</surname>
							<given-names>TV</given-names>
						</name>
						<name>
							<surname>Nguyen</surname>
							<given-names>V-AT</given-names>
						</name>
						<name>
							<surname>Phan</surname>
							<given-names>TV</given-names>
						</name>
						<name>
							<surname>Hii</surname>
							<given-names>SF</given-names>
						</name>
						<name>
							<surname>Traub</surname>
							<given-names>RJ.</given-names>
						</name>
					</person-group>
					<year>2017</year>
					<article-title>Comparison of a new multiplex real-time PCR withthe Kato Katzthick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools</article-title>
					<source>PLoS Negl Trop Dis</source>
					<volume>11</volume>
					<issue>7</issue>
					<elocation-id>e0005743</elocation-id>
					<pub-id pub-id-type="doi">10.1371/journal.pntd.0005743</pub-id>
				</element-citation>
			</ref>
			<ref id="B46">
				<mixed-citation>Wei L, Kelly P, Ackerson K, El-Mahallawy HS, Kaltenboeck B, Wang C. 2014. Molecular detection of <italic>Dirofilaria immitis, Hepatozoon canis, Babesia spp., Anaplasma platys</italic> and <italic>Ehrlichia canis</italic> in dogs on Costa Rica. <italic>Acta Parasitologica</italic>. 60(1). https://doi.org/10.1515/ap-2015-0003</mixed-citation>
				<element-citation publication-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Wei</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Kelly</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Ackerson</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>El-Mahallawy</surname>
							<given-names>HS</given-names>
						</name>
						<name>
							<surname>Kaltenboeck</surname>
							<given-names>B</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>C.</given-names>
						</name>
					</person-group>
					<year>2014</year>
					<article-title>Molecular detection of Dirofilaria immitis, Hepatozoon canis, Babesia spp., Anaplasma platys and Ehrlichia canis in dogs on Costa Rica</article-title>
					<source>Acta Parasitologica</source>
					<volume>60</volume>
					<issue>1</issue>
					<pub-id pub-id-type="doi">10.1515/ap-2015-0003</pub-id>
				</element-citation>
			</ref>
		</ref-list>
		<fn-group>
			<fn fn-type="other" id="fn1">
			
				<p>Clave: e2021-42.</p>
			</fn>
		</fn-group>
	</back>
	<sub-article article-type="translation" id="s1" xml:lang="en">
		<front-stub>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Original Article</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Molecular detection of <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic> in domestic canines from the municipality of Cajeme, Sonora, Mexico</article-title>
			</title-group>
			<abstract>
				<title>ABSTRACT:</title>
				<p>Zoonoses are a worldwide problem with an impact on animal health. This group of diseases include Ehrlichiosis, Anaplasmosis and Rickettsiosis, in which their vector is the tick <italic>Riphicephalus sanguineus</italic>, commonly known as the brown dog tick. Current evidence indicates this microorganism acts as vector of bacterial zoonotic agents including <italic>Ehrlichia canis, Anaplasma platys</italic> and <italic>Rickettsia rickettsii,</italic> which have infected a large number of dogs and humans in northern Mexico. This study was conducted in the municipality of Cajeme, Sonora, using blood samples (n=170) from canine. Molecular techniques were used to detect 92 samples positive for <italic>Ehrlichia spp.,</italic> 47 for <italic>Ehrlichia canis</italic>, 18 for <italic>Anaplasma platys</italic> and 2 for <italic>Rickettsia spp</italic>. In addition, co-infection with <italic>Ehrlichia canis</italic> was found in 12 samples positive for <italic>Anaplasma platys</italic>. Sequencing of one positive of each bacterium was performed, obtaining 100% homology in the &quot;GenBank&quot; platform (NCBI). Our results emphasized the importance of the zoonotic impact and co-infection of these diseases. Moreover, this is the first study confirming the molecular identification of the species <italic>Ehrlichia canis, Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic>, as well as their co-infection, in domestic dogs located in the municipality of Cajeme, Sonora.</p>
			</abstract>
			<kwd-group xml:lang="en">
				<title>Keywords:</title>
				<kwd>zoonoses</kwd>
				<kwd>Ehrlichiosis vectors</kwd>
				<kwd>co-infection</kwd>
				<kwd>molecular techniques</kwd>
			</kwd-group>
		</front-stub>
		<body>
			<sec sec-type="intro">
				<title>INTRODUCTION</title>
				<p>Zoonoses involve several diseases that represent a significant worldwide problem affecting human and animal health (García <italic>et al.,</italic> 2013). Such diseases include Ehrlichiosis, Anaplasmosis and Rickettsiosis which are caused by a gramnegative bacteria characterized by intracellular obligated growth (genus R<italic>ickettsia</italic>, family <italic>Rickettsiaceae</italic>; genus <italic>Ehrlichia</italic> and <italic>Anaplasma</italic>, family <italic>Anaplasmataceae</italic>). These are mainly transmitted by ectoparasites, including <italic>Riphicephalus sanguineus</italic>, the brown dog’s thick, which affect ground vertebrates (<xref ref-type="bibr" rid="B29">Parola <italic>et al</italic>., 2009</xref>; <xref ref-type="bibr" rid="B4">Alvarez, 2017</xref>). Several studies have demonstrated these ectoparasites act as vectors from zoonotic agents including <italic>Erlichia canis, Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic> (<xref ref-type="bibr" rid="B17">Gaunt <italic>et al</italic>., 2010</xref>).</p>
				<p><italic>E. canis</italic> causes a zoonotic disease in dogs, cats and rodents; then, the human is an accidental victim after being stung by the <italic>Rhipicephalus</italic> stick hosted in these animals. After the infection, the microorganism is incubated during 1-2 weeks and enters into the blood and lymphatic vessels; then, it travel to the spleen, liver and lymph nodes to be multiplied by binary fusion for spreading to other body organs (<xref ref-type="bibr" rid="B10">Castro <italic>et al</italic>., 2004</xref>).</p>
				<p><italic>E. canis</italic> is considered as a bacterium of cosmopolitan distribution. In Mexico, it was first described in 1996 and classified as endemic because it has been reported in the whole country, but mainly in northwest states such as Sonora and Sinaloa. In Sonora, <italic>E. canis</italic> is considered as a health emergency and a growing public health issue. Since 2002, more than 600 cases have been reported, the vast majority in municipalities in the north of the state (<xref ref-type="bibr" rid="B4">Álvarez, 2017</xref>; <xref ref-type="bibr" rid="B39">Sosa <italic>et al</italic>., 2013</xref>).</p>
				<p>Clinical signs of the acute phase of the disease are hematologic alterations, leukopenia, thrombocytopenia and mild to moderate anemia; the chronic phase is characterized by thrombocytopenia, epistaxis, nephropathy, dyspnea, hepatomegaly, splenomegaly or lymphadenopathy, inflammatory or hemorrhagic meningitis, among others (<xref ref-type="bibr" rid="B20">Ismail <italic>et al</italic>., 2010</xref>).</p>
				<p><italic>A. platys</italic> is distributed worldwide and it is also transmitted by the ticks <italic>R. sanguineus.</italic> It was first described in 1978 in dogs from United States (<xref ref-type="bibr" rid="B35">Sánchez &amp; Tesouro, 2001</xref>). This bacteria belong to the <italic>Anaplasma</italic> genus (<xref ref-type="bibr" rid="B1">Ábrego <italic>et al.,</italic> 2009</xref>). It causes canine infectious cyclic thrombocytopenia. The disease may present with fever, anorexia, petechiae, uveitis, generalized lymphadenopathy, leukopenia, moderate anemia and especially thrombocytopenia, occurring in episodes of 3-4 days at intervals of 7-21 days, eventually leading to chronic thrombocytopenia with slow recovery (<xref ref-type="bibr" rid="B12">Cicuttin <italic>et al</italic>. 2014</xref>).</p>
				<p>Currently, <italic>A. platys</italic> has been detected with low incidence in the states of Coahuila, Durango and Sonora (<xref ref-type="bibr" rid="B3">Almazán <italic>et al</italic>., 2016</xref>; <xref ref-type="bibr" rid="B26">Murrieta <italic>et al.,</italic> 2017</xref>). As zoonotic disease, <xref ref-type="bibr" rid="B5">Arraga <italic>et al</italic>. (2014)</xref> reported two women in Venezuela who were exposed to <italic>R</italic>. <italic>sanguineus.</italic> Intraplatelet inclusion bodies suggestive of <italic>A. platys</italic> were subsequently observed in smears and <italic>A. platys</italic> DNA was amplified and sequenced from whole blood, although treatment with doxycycline did not alleviate their symptoms. These cases provide additional support for <italic>A. platys</italic> as a tick-borne zoonotic pathogen, most likely of low pathogenicity; however, the cause of <italic>A. platys</italic> disease in humans has not been confirmed.</p>
				<p><italic>R. rickettsii</italic> is the main agent of spotted fever in the Americas; cases have been reported in the U.S., Canada, Mexico, Costa Rica, Panama, Colombia, Brazil and Argentina (<xref ref-type="bibr" rid="B24">López et al., 2007</xref>; <xref ref-type="bibr" rid="B19">Herrero et al., 2010</xref>; <xref ref-type="bibr" rid="B23">Lebruna <italic>et al</italic>., 2011</xref>), with a high mortality rate due to late detection of the pathogen (<xref ref-type="bibr" rid="B27">Oteo <italic>et al</italic>., 2014</xref>). It is considered that Mexico has the ideal conditions for the transmission cycle of the disease, commonly associated with living conditions (poverty) since most of the cases presented have been detected in marginalized and rural areas of Mexico (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>). Recent studies demonstrated the presence of <italic>Rickettsia spp.</italic> in ticks from the state of Sonora by PCR technique (<xref ref-type="bibr" rid="B16">Foley <italic>et al</italic>., 2019</xref>).</p>
				<p>These pathogens could be present previously in the tick, causing simultaneous co- infections in the host (i.e. more than one agent can be transmitted), which will be causing the disease at the same time. This can result in the manifestation of clinical signs, in a more severe and non-specific way, being a disadvantage for the clinical diagnosis by human and veterinary physicians attending these cases (<xref ref-type="bibr" rid="B2">Alleman &amp; Wamsley, 2008</xref>; <xref ref-type="bibr" rid="B44">Mutz et al., 2009</xref>).</p>
				<p>Considering the zoonotic importance of these diseases, and that no previous studies have been reported in the municipality of Cajeme, Sonora, the presence of vectors of <italic>E. canis,</italic></p>
				<p><italic>A. platys</italic> and <italic>R. rickettsii</italic> in domestic dogs in the municipality is suggestive of the presence of these zoonotic diseases. Therefore, the objective was the molecular identification of the species <italic>E. canis</italic>, <italic>A. platys</italic> and <italic>R. rickettsii</italic> to determine their co-infection in domestic dogs in the municipality of Cajeme, Sonora.</p>
			</sec>
			<sec sec-type="materials|methods">
				<title>MATERIAL AND METHODS</title>
				<sec>
					<title>Type of study</title>
					<p>A descriptive observational study was conducted to detect the presence of <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic>.</p>
				</sec>
				<sec>
					<title>Study area</title>
					<p>The present work was carried out from blood samples of dogs sent to the Laboratory of Molecular Biology of Veterinary Medicine and Zootechnics of the Technological Institute of Sonora, coming from private veterinary clinics in the town of Cajeme in the state of Sonora, Mexico.</p>
				</sec>
				<sec>
					<title>Experimental sampling</title>
					<p>We used 170 canine whole blood samples with EDTA anticoagulant from a commercial veterinary diagnostic laboratory located in Ciudad Obregon, Sonora. Only canines with presumptive clinical diagnosis or positive for <italic>E. canis, A. platys</italic> and <italic>R. rickettsii</italic> were selected based on the symptomatology presented and complementary analyses performed, such as blood smears and hemograms. The samples were transported to the Veterinary Molecular Biology Laboratory at ITSON and in all cases were kept at 4°C until their final processing, for a period of no more than 24 hours.</p>
				</sec>
				<sec>
					<title>Blood sample processing</title>
					<p>The samples were thawed and centrifuged for 15 minutes at 3,500 rpm in order to obtain 200 µl of leukoplatelet layer and start the extraction of the genetic material.</p>
				</sec>
				<sec>
					<title>Extraction of bacterial DNA</title>
					<p>For DNA extraction from blood samples, the commercial DNeasy Blood and Tissue Kit (QIAGEN®) were used following the manufacturer's instructions. The quantity, quality and purity of DNA were measured in an automatic spectrophotometer BioSpect-nano (Shimadzu), and the integrity was observed in 1.5% agarose gel stained with 1.5 µl ethidium bromide.</p>
				</sec>
				<sec>
					<title>Synthesis of positive controls</title>
					<p>The BLASTn GenBank® tool of the NCBI (National Center for Biotechnology Information) database was used to download the sequences obtained from the alignments. Such alignments were performed using the specific primers of the bacteria <italic>Ehrlichia canis, Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic>, in FASTA format. We used 50 bp upstream from the first forward and 50 bp downstream from the first reverse where the oligonucleotides were aligned. The sequences were entered into the IDT (Integrated DNA Technologies) platform for the synthesis of the gBlocks™ gene fragments, facilitating standardization for PCR detection of each of the microorganisms under study.</p>
				</sec>
				<sec>
					<title>Amplification by PCR</title>
					<p>The DNA samples were analyzed by polymerase chain reaction (PCR) using the primer sets described in <xref ref-type="table" rid="t4">Table 1</xref>. Initially, PCR assays targeted the genera <italic>Eherlichia spp., Anaplasma spp.</italic> and <italic>Rickettsia spp</italic>. Samples that tested positive for each genus were subjected to their second PCR with primers specific for <italic>E. canis, A. platys</italic> and <italic>R. rickettsii</italic>. For the reactions was used the GoTaq® Flexi DNA Polymerase PCR preloaded kit (Promega) containing Green GoTaq®, which serves as reaction buffer and gel loading solution, allowing to load reactions directly for fast and efficient analysis. Reactions were run in a final volume of 25 μl, starting with the manufacturer's concentrations: 1X Green GoTaq Buffer 5x, 1.5mM MgCl2, 0.2 mM for each dNTP, 0.4 μM of each primer, 1.25u of GoTaq DNA Polymerase, 2 μl of DNA and nuclease-free H2O to 25 µL. The product was identified on 1.5% agarose gel and ethidium bromide, considering positive bands with the size of each agent.</p>
					<p>
						<table-wrap id="t4">
							<label>Table 1</label>
							<caption>
								<title>Primers used for agent detection in canine blood samples</title>
							</caption>
							<table>
								<colgroup>
									<col/>
									<col/>
									<col/>
									<col/>
									<col/>
									<col/>
									<col/>
								</colgroup>
								<thead>
									<tr>
										<th align="center">Agent</th>
										<th align="center">Primers (5’-3’)</th>
										<th align="center">Gen</th>
										<th align="center">pb</th>
										<th align="center">Primer Tm</th>
										<th align="center">ID sequence</th>
										<th align="center">Reference</th>
									</tr>
								</thead>
								<tbody>
									<tr>
										<td align="justify"><italic>Ehrlichia</italic> spp.</td>
										<td align="justify">ECC-AGAACGAACGCTGGCGGCAAGCC ECB-CGTATTACCGCGGCTGCTGGC</td>
										<td align="center">16S</td>
										<td align="center">478</td>
										<td align="center">61 °C</td>
										<td align="center">MH020203.1</td>
										<td align="center">Dawson <italic>et al.</italic> (1996)</td>
									</tr>
									<tr>
										<td align="justify"><italic>Rickettsia</italic> spp.</td>
										<td align="justify">CS78- GCAAGTATCGGTGAGGATGTAAT Cs323- GCTTCCTTAAAATTCAATAAATCAGGAT</td>
										<td align="center"><italic>gltA</italic></td>
										<td align="center">401</td>
										<td align="center">48 °C</td>
										<td align="center">MG717529.1</td>
										<td align="center">Labruna <italic>et al.</italic> (2004)</td>
									</tr>
									<tr>
										<td align="justify"><italic>Ehrlichia canis</italic></td>
										<td align="justify">HE-TATAGGTACCGTCATTATCTTCCCTAT ECA-CAATTATTTATAGCCTCTGGCTATAGGAA</td>
										<td align="center">16S</td>
										<td align="center">389</td>
										<td align="center">57.4 ºC</td>
										<td align="center">KX818219.1</td>
										<td align="center">Murphy <italic>et al.</italic> (1998)</td>
									</tr>
									<tr>
										<td align="justify">Anaplasma platys</td>
										<td align="justify">pla-HS475-AAGGCGAAAGAAGCAGTCTTA pla-HS1198-CATAGTCTGAAGTGGAGGAC</td>
										<td align="center"><italic>groEl</italic></td>
										<td align="center">724</td>
										<td align="center">58 ºC</td>
										<td align="center">EU516386.1</td>
										<td align="center">Inokuma <italic>et al</italic>., 2002</td>
									</tr>
									<tr>
										<td align="justify"><italic>Rickettsia rickettsii</italic></td>
										<td align="justify">Rr190.70p-ATGGCGAATATTTCTCCAAAA Rr190.602n-AGTGCAGCATTCGCTCCCCCT</td>
										<td align="center">ompA</td>
										<td align="center">530</td>
										<td align="center">48 °C</td>
										<td align="center">U55822.1</td>
										<td align="center">Regnery <italic>et al.</italic>, 1991</td>
									</tr>
								</tbody>
							</table>
						</table-wrap>
					</p>
				</sec>
				<sec>
					<title>Sequencing and in silico analyses of amplified fragments</title>
					<p>A PCR product from each microorganism that was positive, it was also purified with the commercial kit Wizard® SV Gel and PCR Clean-Up System (Promega) to corroborate that the amplified fragment belongs to the regions of interest. Amplicons were then sequenced using the Sanger process performed at Langebio Cimvestav Lab Irapuato unit. The fragments generated with nucleotide sequences representative of each bacterium were analyzed with the Snapgene Viewer program, and subjected to the BLASTn algorithm to evaluate the percentage of homology of each agent with the sequences available in the GenBank database.</p>
				</sec>
			</sec>
			<sec sec-type="results">
				<title>RESULTS</title>
				<p>It was observed by electrophoresis that all the extracted DNA showed a good integrity of the molecules and yielded an average quantification by spectrophotometry of 248.32 ng/µl in the leukoplatelet layer samples. A purity value of 1.85 measured through the ratio 260- 280 indicate the DNA as “pure”, using samples from whole blood with EDTA.</p>
				<p>For the PCR technique, a concentration of 0.5 ng/µl of each gblocks was used as positive controls, obtaining the corresponding base pairs of each agent, achieving good efficiency and speed for molecular standardization.</p>
				<p>The number of positive cases and frequency of <italic>Ehrlichis spp</italic>., <italic>Ehrlichia canis, Anaplasma platys</italic> and <italic>Rickettsia spp</italic>. obtained from molecular analysis of canine blood samples (n=170) are described in <xref ref-type="table" rid="t5">Table 2</xref>. Of the 92 samples that tested positive for <italic>Ehrlichia spp.</italic> 12 co-infections (<xref ref-type="table" rid="t6">Table 3</xref>) of <italic>Ehrlichia canis</italic> with <italic>Anaplasma platys</italic> (Genus EA) were found (13%).</p>
				<p>
					<table-wrap id="t5">
						<label>Tabla 2</label>
						<caption>
							<title>Number of cases and frequency of <italic>Ehrlichia canis, Anaplasma platys and Rickettsia rickettsi</italic> in dogs from Cajeme, Sonora, by PCR (n = 170)</title>
						</caption>
						<table>
							<colgroup>
								<col/>
								<col span="2"/>
							</colgroup>
							<thead>
								
							
							<tr>
									<th align="center">Agente</th>
								<th align="center" colspan="2">PCR </th>
								</tr>
								<tr>
									<th align="justify"> </th>
									<th align="center">Positives</th>
									<th align="center">Frequency</th>
								</tr></thead>
							<tbody>
								<tr>
									<td align="justify"><italic>Ehrlichia spp</italic></td>
									<td align="justify">92</td>
									<td align="justify">54%</td>
								</tr>
								<tr>
									<td align="justify">Ehrlichia canis</td>
									<td align="justify">47</td>
									<td align="justify">28%</td>
								</tr>
								<tr>
									<td align="justify">Anaplasma platys</td>
									<td align="justify">18</td>
									<td align="justify">11%</td>
								</tr>
								<tr>
									<td align="justify">Rickettsia spp.</td>
									<td align="justify">2</td>
									<td align="justify">0.8%</td>
								</tr>
							</tbody>
						</table>
					</table-wrap>
				</p>
				<p>
					<table-wrap id="t6">
						<label>Table 3</label>
						<caption>
							<title>Co-infections and frequency in positive dogs to the genus EA</title>
						</caption>
						<table>
							<colgroup>
								<col/>
								<col/>
							</colgroup>
							<thead>
								
							
							<tr>
									<th align="justify"><italic>Co-infecciones</italic></th>
									<th align="justify">PCR</th>
							</tr></thead>
							<tbody>
								<tr>
									<td align="justify"><italic>(E. canis / A. platys)</italic></td>
									<td align="justify">Positives 92</td>
								</tr>
								<tr>
									<td align="justify">Positives</td>
									<td align="justify">12</td>
								</tr>
								<tr>
									<td align="justify">Frequency</td>
									<td align="justify">13%</td>
								</tr>
							</tbody>
						</table>
					</table-wrap>
				</p>
				<p>In addition, sequencing of 1 sample of each positive for the different species of microorganisms analyzed was performed, obtaining pure chromatograms analyzed with the SanpGene Viewer program. The analysis of the sequences in the BLASTn program (National Center for Biotechnology Information) detected a similarity between 99 and 100% with the previously reported sequences.</p>
			</sec>
			<sec sec-type="discussion">
				<title>DISCUSSION</title>
				<p>Microorganisms of the order Rickettsiales have zoonotic conditions called Rickettsiosis, Ehrlichiosis and Anaplasmosis that are due to several pathogens of veterinary importance that have gained ground not only in our region but also worldwide (<xref ref-type="bibr" rid="B32">Rodríguez <italic>et al</italic>. 2016</xref>), this is mainly due to its vector <italic>Rhipicephalus sanguineus</italic>, being the most commonly reported tick species and with the greatest geographic distribution (<xref ref-type="bibr" rid="B40">Sosa <italic>et al.</italic>, 2016</xref>; <xref ref-type="bibr" rid="B6">Cabezas-Cruz <italic>et al</italic>., 2019</xref>). These pathogens are increasing due to the activity of human beings that has generated radical changes in the environment, favoring vector-borne diseases (<xref ref-type="bibr" rid="B41">Suthers, 2004</xref>) and increasing their prevalence in late spring and summer. Due to the fact that these ectoparasites increase their activity in high ambient temperatures during these seasons of the year, inoculating the mentioned hemoparasites more quickly (<xref ref-type="bibr" rid="B29">Parola <italic>et al</italic>., 2009</xref>), necessitating the standardization of precise techniques for the detection of these zoonotic microorganisms of the <italic>Rickettsiales</italic> order in Tropicales and Subtropicales regions.</p>
				<p>Currently using gBlocks gene fragments as positive controls used in this study have become popular as standards and synthetic positives for the detection of bacterial microorganisms. Currently similar data were reported in Barcelona where this type of fragments were used for detection of E. coli, <italic>E. faecalis</italic> and Legionella <italic>pneumiphilia</italic> (<xref ref-type="bibr" rid="B7">Cardenas, 2018</xref>); also, in Australia such fragments were used as standards in the multiplex PCR detection of <italic>Taenia spp</italic>. (<xref ref-type="bibr" rid="B45">Ng-Nguyen <italic>et al</italic>., 2017</xref>) Therefore, the use of gBlocks for PCR standardization is recommended as it increased the speed of the bioassay in detection due to the lack of availability of biological isolates.</p>
				<p>The study was the first work using PCR to detect the species <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> and <italic>Rickettsia rickettsi</italic> in blood samples from dogs in the municipality of Cajeme and in Sonora, allowing to know the expanded geographical distribution of the three pathogens in the state. The percentage of 54% to at least one pathogenic agent in our study agrees with investigations performed using molecular tools in some South and Central American countries, where Brazil reported 69% (<xref ref-type="bibr" rid="B42">Tanikawa <italic>et al</italic>., 2013</xref>), Nicaragua 80% (<xref ref-type="bibr" rid="B46">Wei <italic>et al.</italic>, 2014</xref>), Panama 70.6% (<xref ref-type="bibr" rid="B36">Santamaria <italic>et al</italic>., 2014</xref>), Costa rica 45% (Rojas <italic>et al</italic>., 2015) and El Salvador 60% (<xref ref-type="bibr" rid="B25">Miranda <italic>et al</italic>., 2018</xref>). Our prevalence percentage differed when was compared with high percentages of other countries, probably because they worked with dogs without owners and being more in contact with the vector of the diseases as it is associated with living conditions in marginalized areas (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>). Prevalence to hemoparasites have been reported in some other states of Mexico, where Sinaloa reports 74.3% (<xref ref-type="bibr" rid="B39">Sosa-Gutiérrez <italic>et al</italic>., 2013</xref>), Coahuila and Durango 41% (<xref ref-type="bibr" rid="B3">Almazán <italic>et al</italic>., 2016</xref>), Yucatán 69% (<xref ref-type="bibr" rid="B14">Díaz <italic>et al</italic>., 2016</xref>), Chihuahua 40% (<xref ref-type="bibr" rid="B15">Escárcega <italic>et al</italic>., 2018</xref>) and Sonora 33% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>). As early mentioned, Cajeme yielded 57% of infection, positioning Sonora at this time as one of the main states with the highest incidence in tropical and subtropical regions where parasites and the vector are present.</p>
				<p>Regarding the percentage of presence of each hemoparasite, our study evidenced the higher prevalence of <italic>E. canis</italic> reported in Mexico (28%). Other studies reported lower results. In the municipality of San Luis Rio Colorado, 8% of infection for <italic>E. canis</italic> was found in blood samples from 235 dogs (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>); also, in the State of Coahuila and Durango 10% was found in a population of 100 healthy dogs infested with ticks (<xref ref-type="bibr" rid="B3">Almazán <italic>et al</italic>., 2016</xref>). In Yucatan, 36% was determined in a population of 50 dogs (10 domestic dogs and 40 in an animal control center), where all positive dogs were from samples collected from the animal shelter, representing a prevalence of 45% for this sampling site (<xref ref-type="bibr" rid="B28">Path <italic>et al</italic>., 2015</xref>). There are also findings in other countries such as Buenos Aires, Argentina, where the results were similarly lower in a population of 223 dogs, obtaining 6.7% of positives to <italic>E. Canis</italic> (<xref ref-type="bibr" rid="B13">Cicuttin, 2016</xref>), Uruguay is one of the few countries which reported the presence of other hemoparasites, but not the presence of <italic>E. Canis</italic> in a population of 191 dogs (<xref ref-type="bibr" rid="B8">Carvalho, 2017</xref>). In contrast to Brazil, the percentage in our study was lower because the worked with 472 dogs in the Brazilian northeast detecting 34.5% of positive dogs (<xref ref-type="bibr" rid="B38">Silva <italic>et al</italic>., 2010</xref>), Colombia represents the largest area with high prevalence reviewed on <italic>E. canis</italic>, mainly the municipalities of Palmira (92.8%) and Cartago (90%) (<xref ref-type="bibr" rid="B34">Rojas <italic>et al</italic>., 2013</xref>). However, it is worth mentioning that this work was performed on stray dogs unlike our study.</p>
				<p>The presence of <italic>Anaplasma platys</italic> (11%) in our study, turned out to be higher than those reported in Buenos Aires, Argentina of 223 dogs, being positive for <italic>A. platys</italic> 7.2% (<xref ref-type="bibr" rid="B13">Cicuttin, 2016</xref>). In Uruguay, out of 191 dogs, 4.2% were positive (<xref ref-type="bibr" rid="B8">Carvalho, 2017</xref>). Also in San Luis Rio Colorado, Sonora in 235 canine samples were positive for 18% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al.</italic>, 2017</xref>). Other publications show similar values to Costa Rica with 10% (<xref ref-type="bibr" rid="B46">Wei <italic>et al</italic>., 2014</xref>), Nicaragua 13% (<xref ref-type="bibr" rid="B33">Rojas <italic>et al</italic>., 2014</xref>), Cuba 16% (<xref ref-type="bibr" rid="B37">Silva <italic>et al</italic>., 2016</xref>) and El Salvador with 17% (<xref ref-type="bibr" rid="B26">Murrieta, 2017</xref>), but proved to be lower with respect to Panama with 21.3%. In Brazil, in a population of 100 dogs, a higher prevalence was obtained for <italic>Anaplasma platys</italic> with 21% and 9% for <italic>Ehrlichia</italic>, being one of the few studies that differs in our results, since, in our work and most of the research conducted in Central and South America, they report a lower incidence of A. platys than <italic>E. canis</italic>.</p>
				<p>The molecular diagnosis in our research of hemoparasites related to <italic>Ehrlichia</italic> and <italic>Anaplasma</italic> has been easy to identify, unlike the bacterium <italic>Rickettsia rickettsii</italic> with the PCR technique from blood samples in canines. Our prevalence percentage to this agent was lower (0.8%) compared to <italic>E. canis</italic> and <italic>A. platys</italic>, this may be because it is typically mentioned that low numbers of <italic>rickettsiae</italic> circulate in the blood in the absence of advanced disease or fulminant infection (<xref ref-type="bibr" rid="B11">CDC, 2017</xref>; <xref ref-type="bibr" rid="B43">Tinoco <italic>et al</italic>., 2018</xref>).</p>
				<p>Due to this we found in the literature different investigations, mostly directed to the diagnosis of Rickettsia spp. and <italic>R. rickettsii</italic> in <italic>R. sanguineus</italic> ticks in dogs from different regions, as is the case of Yucatan, selected 28 dogs where 106 <italic>Rhipicephalus sanguineus</italic> ticks were collected with a 26% incidence (<xref ref-type="bibr" rid="B30">Peniche <italic>et al</italic>., 2015</xref>) In Matamoros, Coahuila, the endpoint PCR technique was performed for the analysis of 100 ticks (<italic>Rhipicephalus sanguineus</italic>) giving as positive to <italic>Rickettsia spp</italic> 4% of the samples analyzed (<xref ref-type="bibr" rid="B9">Castillo <italic>et al., 2015</italic></xref>). In Mexicali Baja California, Mexico, dog ticks belonging to the morphology of <italic>Rhipicephalus sanguineus</italic> were analyzed by means of PCR, resulting in positive samples with 100% homology to <italic>R. rickettsii</italic> (<xref ref-type="bibr" rid="B16">Foley <italic>et al</italic>., 2019</xref>). Currently Sonora leads the entities with the most reports of Rickettsiasis in the country, being Cajeme one of the main cities with more cases of death, despite being a data associated with public health, it is important to know the incidence of <italic>R. rickettsii</italic> in animals (<xref ref-type="bibr" rid="B31">PSS, 2014</xref>), giving greater importance to our work, because not only Rickettsia spp. but <italic>R. rickettsii</italic> was also detected, with 100% homology to the genus with the gltA gene and the species with the OmpA gene in blood samples from 2 dogs (n = 170), these genes are the most used for the detection of the bacteria that cause spotted fever.</p>
				<p>The results obtained from the three agents, increases the alert and the incidence of cases associated with <italic>Rickettsiales</italic> in the state of Sonora transmitted by the brown tick <italic>Riphicephalus sanguineus</italic>. It is currently the most important vector of Rickettsiales in Mexico (<xref ref-type="bibr" rid="B22">Labruna, 2009</xref>), constituting a public health problem, since <italic>R. rickettsii, E. canis</italic> and <italic>A. platys</italic> are considered zoonotic disease by the CDC in 2017 and that over the years have acquired greater territory of infection. As mentioned above, these pathogens can be present in the tick, causing simultaneous co-infections in the host, i.e. more than one single agent can be transmitted, as demonstrated in the present investigation, finding 13% of co-infection to the agents <italic>E. canis</italic> and <italic>A. platys</italic>.</p>
				<p>The presence of co-infection with these bacteria in our study is not a strange finding, since they are the most common in Latin America. In our study we have similar percentages obtained in Panama, which report a co-infection between <italic>E. canis</italic> and <italic>A. platys</italic> of 7.5% (<xref ref-type="bibr" rid="B36">Santamaría <italic>et al</italic>., 2014</xref>), El Salvador with 4.5% (<xref ref-type="bibr" rid="B25">Miranda <italic>et al</italic>., 2018</xref>) and San Luis Rio Colorado, Sonora with 12.2% (<xref ref-type="bibr" rid="B26">Murrieta <italic>et al</italic>., 2017</xref>), mentioning that the latter is very similar to our co-infection results and is from the same state.</p>
				<p>It is essential to consider that the remaining 46% of the negative samples in the study to genus and species, may be due to the absence of the pathogens or the presence of other diseases, because in the investigation all blood samples came from presumptive dogs or manifested clinical symptoms, although it may also be due to the presence in undetectable low quantities of the pathological agents<bold>.</bold></p>
				<p>Finally, it is important to highlight that the differences found between the samples positive to genus and negative to <italic>E. canis, A. platys</italic> and <italic>R. rickettsi</italic> species are probably due to the fact that the primers used in the first genus PCR (ECC/ECB) also amplify other species, which could indicate infection by other <italic>Ehrlichia</italic> species (<italic>E. ewingii</italic> or others) or other species of the <italic>Anaplasmataceae</italic> family (<italic>A. phagocytophilum</italic> or others).</p>
			</sec>
			<sec sec-type="conclusions">
				<title>CONCLUSIONS</title>
				<p>The percentage of haemoparasites in domestic dogs reported in this study, currently positions Sonora as one of the main states with the highest frequency in tropical and subtropical regions. The three agents were detected by molecular technics in the blood of suspected dogs from the city of Cajeme, Sonora, identifying <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic> with frequencies of 28%, 11% and 0.8%, respectively. In addition, these three agents were confirmed by sequencing. Regarding co-infections, only <italic>Ehrlichia canis</italic> and <italic>Anaplasma platys</italic> were detected simultaneously with 13% of frequency.</p>
				<p>To our knowledge, this is the first molecular identification investigation in our state, confirming the presence of <italic>Ehrlichia canis</italic>, <italic>Anaplasma platys</italic> and <italic>Rickettsia rickettsii</italic> starting from whole blood of canines. However, further studies are suggested to explore the frequency of these infectious agents in other regions from the state on Sonora.</p>
			</sec>
		</body>
		<back>
			<fn-group>
				<fn fn-type="other" id="fn2">					
					<p>Code: e2021-42.</p>
				</fn>
			</fn-group>
		</back>
	</sub-article>
</article>