avAbanico veterinarioAbanico vet2007-428X2448-6132Sergio Martínez González10.21929/abavet2021.2900119Artículo OriginalDetección molecular de Ehrlichia canis y Anaplasma phagocytophilum y alteraciones hematológicas de perros infectados0000-0003-1282-8713Merino-CharrezOctavio10000-0003-4261-5655Badillo-MorenoValeria10000-0002-6820-2974Loredo-OstiJorge10000-0001-7590-319XBarrios-GarcíaHugo10000-0001-6376-9771Carvajal-de-la-FuenteVerónica*1Facultad de Medicina Veterinaria y Zootecnia “Dr. Norberto Treviño Zapata”. Universidad Autónoma de Tamaulipas, km 5, Carretera Victoria-Mante, Ciudad Victoria, Tamaulipas, CP 87000, México. Universidad Autónoma de TamaulipasFacultad de Medicina Veterinaria y Zootecnia “Dr. Norberto Treviño Zapata”Universidad Autónoma de TamaulipasTamaulipasMexicoAutor para correspondencia: Verónica Carvajal-de-la-Fuente. Carretera Victoria-Mante km 5. CP. 87000, Ciudad Victoria, Tamaulipas, México. omerino@docentes.uat.edu.mx, valeria.badillo@live.com, jloredo@docentes.uat.edu.mx, hbarrios@docentes.uat.edu.mx, vcarvajal@docentes.uat.edu.mx31102021Jan-Dec202111e1190903202114062021Este es un artículo publicado en acceso abierto bajo una licencia Creative CommonsRESUMEN:
Las ehrlichiosis y anaplasmosis canina son enfermedades transmitidas por garrapatas, provocadas por bacterias del género Ehrlichia y Anaplasma. Debido a sus múltiples manifestaciones clínicas, su diagnóstico es un reto para el veterinario. La distribución de estos hemoparásitos incluye áreas donde su principal vector, Rhipicephalus sanguineus está presente. Este estudio fue diseñado para determinar la presencia Ehrlichia canis y Anaplasma phagocytophilum, así como los factores asociados y hallazgos hematológicos comunes en perros de la zona centro de Tamaulipas. Se evaluaron, a través de PCR, 384 muestras de sangre provenientes de animales de diferentes clínicas veterinarias y un refugio. El análisis de datos se realizó con la prueba Chi cuadrada con un nivel de significancia de 0.05. Los resultados muestran que, del total de muestras 103 (26.8%) resultaron positivas a E. canis, mientras que para A. phagocytophilum no se detectó ningún caso. No se observó asociación significativa con relación al sexo, raza, ni lugar de procedencia (p>0.05), a diferencia de la edad, donde se encontró mayor prevalencia de E. canis para adultos (15-84 meses) (p<0.05). En relación con el hematocrito, conteo de plaquetas, proteínas plasmáticas totales, conteo y diferencial leucocitario, no existió diferencias significativas (p>0.05).
La ehrlichiosis y anaplasmosis son enfermedades de gran importancia tanto para la salud
veterinaria como pública, ya que son responsables de enfermedades como la
Ehrlichiosis Monocítica y Anaplasmosis Granulocítica Humana (Vieira et al., 2013; Farhan 2015; Rodríguez-Vivas
et al., 2019). Son provocadas por bacterias
intracelulares obligadas Gram negativas conocidas como Ehrlichia
spp. y Anaplasma spp. respectivamente (Harrus y Waner 2011; Stuen
et al., 2013). A nivel mundial, los
casos se han incrementado considerablemente en los últimos años principalmente en
zonas tropicales y subtropicales donde proliferan las garrapatas vectoras
(Rhipicephalus sanguineus e Ixodes spp) (Beugnet y Chalvet-Monfray 2013; Irwin 2014; Little et
al., 2014; Battilani
et al., 2017). Debido a la cercanía cada vez mayor
de las personas con sus mascotas, la probabilidad de picaduras por estos
ectoparásitos aumenta considerablemente propiciando a que estas infecciones se están
convirtiendo en zoonosis reemergentes (Bhadesiya y
Modi 2015; Ismail y McBride
2017).
En México, la Ehrlichiosis canina se reportó por primera vez en 1996, desde entonces el número de casos se ha incrementado considerablemente (Maggi y Krämer 2019); no obstante, el diagnóstico, en muchas ocasiones se basa en signos clínicos sin realizar pruebas de laboratorio que corroboren directa o indirectamente su presencia. El diagnóstico definitivo se centra en técnicas microscópicas; sin embargo, estos métodos tienen baja sensibilidad y especificidad en pacientes con una baja bacteremia, lo cual evita establecer la terapéutica adecuada (Harrus y Waner 2011; Allison y Little 2013). En respuesta a esto, la Reacción en Cadena de la Polimerasa (PCR) surge como una importante herramienta de apoyo a los métodos de diagnóstico convencionales (Almazan et al., 2016; Cetinkaya et al., 2016; de la Fuente et al., 2017).
El estado de Tamaulipas por su ubicación geográfica cuenta con características idóneas que favorecen el desarrollo de garrapatas vectoras de estas enfermedades (Tinoco-Gracia et al., 2009); sin embargo, se desconoce la verdadera magnitud de este problema. Por lo tanto, el principal objetivo de esta investigación fue determinar la presencia de E. canis y A. phagocytophilum, a través de PCR, en perros naturalmente infectados en la zona centro de Tamaulipas; así como evaluar algunos factores asociados a la presencia de estas enfermedades.
MATERIAL Y MÉTODOSÁrea de estudio
El presente trabajo se realizó con muestras sanguíneas de perros remitidas (durante el periodo marzo de 2020 a marzo de 2021) al Laboratorio de Parasitología y Análisis Clínicos de la Facultad de Medicina Veterinaria y Zootecnia “Dr. Norberto Treviño Zapata”, perteneciente a la Universidad Autónoma de Tamaulipas. Asimismo, con muestras provenientes de varias clínicas veterinaria particulares de la capital de Tamaulipas y algunos municipios aledaños.
Población de estudio
Se utilizó un muestreo no probabilístico, en el cual se analizaron las muestras de pacientes que se remitieron con los siguientes criterios de inclusión: 1) ser del estado de Tamaulipas (zona centro), 2) presentar signos clínicos relacionados con hemoparásitos (fiebre, diarrea, uveítis, petequias, epistaxis, trastornos osteoarticulares, respiratorios, reproductivos y neurológicos), 3) presentar o haber estado en contacto con garrapatas y 4) tener el consentimiento del propietario de la mascota. El tamaño de muestra fue de 384 animales, que es el tamaño de muestra mínima que se obtiene de la fórmula de (n) para proporciones de poblaciones infinitas, ya que no existe un padrón de población canina en la zona a evaluar (Wayne y Chad 2013). Todos los perros fueron manejados de acuerdo con las normas oficiales de bienestar animal establecido por el Comité de Bioética de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad Autónoma de Tamaulipas.
Colección de muestras
Se obtuvo un mínimo de 3 ml de sangre por punción venosa (vena cefálica), los cuales fueron transferidos rápidamente a un tubo (BD Vacutainer®) con anticoagulante EDTA K2 (ácido etilendiaminotetraacético potásico). Las muestras se mantuvieron en refrigeración (8°C) por no más de 24 horas antes de ser procesada para su evaluación hematológica. Se guardó una alícuota de sangre en viales de 1.5 ml y se almacenó a -20 °C para su posterior extracción de ADN y prueba de PCR. En todos los casos se registró la edad, sexo, raza y estación del año en que se tomó la muestra de los individuos estudiados.
Análisis hematológico
La determinación de los parámetros hematológicos se realizó de forma inmediata, sin que pasaran más de 4 horas de haber obtenido la sangre para evitar alteraciones morfológicas de las células. Las muestras fueron analizadas en un equipo automatizado (Auto Hematology Analyzer, MINDRAY, BC-2800 Vet; Shenzhen, China). Para la determinación de las proteínas plasmáticas se utilizó el método del microhematocrito, utilizando tubos capilares sin heparina; los cuales se llenaron con – partes con sangre, se sellaron y centrifugados (centrífuga KHT-410E Kendal Import S.A.C Gemmy Taiwan) a 11,500 rpm durante 5 min. El plasma obtenido fue colocado en un refractómetro (American Optical) y se obtuvo el total de proteínas. Se realizó el conteo de diferencial leucocitario de manera manual. El primero consistió en valorar y contar en un frotis sanguíneo (teñido con Diff-Quik™) 100 células nucleadas y así obtener el recuento porcentual de los diferentes leucocitos: neutrófilos, eosinófilos, linfocitos, monocitos y basófilos. Para determinar si existía la presencia de anemia se tomó en cuenta el valor del hematocrito, el cual fue categorizado en 2 grupos, con y sin presencia de anemia. El conteo de plaquetas y proteínas totales fueron divididos en 2 grupos, animales con y sin trombocitopenia y con y sin presencia de hiperproteinemia respectivamente. El total de leucocitos, así como sus distintas poblaciones fueron agrupadas como conteos normales, altos y disminuidos.
Identificación de hemoparásitos por microscopía
Para la búsqueda de hemoparásitos por microscopía se elaboraron frotis sanguíneos, los cuales fueron fijados con metanol durante 5 minutos y teñidos con solución Giemsa al 10% durante 15 min. Posteriormente se evaluaron al microscopio con el objetivo de inmersión (100x) múltiples áreas aleatorias de la monocapa y cola del frotis; aquí se buscó la presencia de mórulas (agregados citoplasmáticos de color basofílico) o cualquier otro cuerpo de inclusión compatible con hemoparásitos (Dulmer et al., 2001).
ANÁLISIS MOLECULARObtención de ácidos nucleicos
De las alícuotas de sangre con EDTA almacenadas se realizaron extracciones de ADN mediante el kit comercial de extracción y purificación de ADN (Wizard® Genomic DNA Purification-Promega), de acuerdo con los protocolos establecidos por la compañía. El ADN total extraído fue cuantificado, utilizando un espectrofotómetro (NanoDrop2000®, Thermo Scientific, Waltham, MA, Estados Unidos) y conservado a -20 °C hasta su posterior uso en las pruebas de PCR.
Reacción en Cadena de la Polimerasa
Para el análisis molecular se amplificó una región del gen GltA (utilizado para la identificación de rickettsias que codifica para la enzima citrato sintasa) para E. canis y una región del gen MSP4 (complejo principal de superficie) para A. phagocytophilum. Se utilizó el kit GoTaq® Green Master Mix (Promega, Madison, WI USA. Cat. Num: M7122) de acuerdo a los protocolos establecidos por la empresa. Para esto se utilizó 21 µl de solución del kit, 1 µl del cebador sentido, 1 µl del cebador antisentido y 2 µl del ADN de cada muestra para alcanzar un volumen final de 25 µl. Posteriormente las muestras fueron amplificadas en el termociclador (Applied Biosystems™ Num:2720) con el protocolo de amplificación que se muestra en la tabla 1. Los productos amplificados se analizaron mediante electroforesis en gel de agarosa al 2% en 600 ml de TAE Buffer, 1X (Promega, Madison, WI USA. Cat. Num: V4271) a 120 V por 40 minutos utilizando el colorante de ácidos nucleicos Diamond Nucleic Acid Dye (Promega, Madison, WI USA. Cat.Num: H1181) y posteriormente visualizando bajo luz UV del transiluminador UVP (Productos Ultravioleta, Inc., California, USA. Cat. Num: TFM-30). Se utilizó como control positivo fragmentos de ADN de longitudes conocidas (E. canis, 200 pb; A. phagocytophilum: 980 pb) y un marcador de peso molecular de 100 bp DNA Ladder (Promega, Madison, WI USA. Cat. Num: G210A) como referencia.
Secuencia de los oligonucleótidos utilizados para cada patógeno, protocolo de amplificación y tamaño del amplificado
Organismo y gen diana
Secuencia de oligonucleótidos (5'-3')
Programa de amplificación
Tamaño del amplificado (pb)
Referencia
95°C por 5 min
E. canis
E. canis Fw ATAAACACGCTGACTTTACTGTTCC
94°C por 30 s
200
Stich et al., 2002
60 °C por 30 s
(GltA)
E canis Rev GTGATGAGATAGAGCGCAGTACC
72 °C por 1 min
72 °C por 7 min
35 ciclos
94°C por 5 min
A. phagocytophilum
MSP4AP5 ATGAATTACAGAGAATTGCTTGTAGG
94°C por 30 s
50 °C por 30 s
849
Yousefi et al.,2019
MSP4AP3
72 °C por 30 s
(Msp4)
TTAATTGAAAGCAAATCTTGCTCCTATG
72 °C por 7 min
35 ciclos
Análisis estadísticos
Se representaron las frecuencias absolutas y porcentajes de casos positivos y hallazgos hematológicos. El grado de asociación entre la presencia de patógenos y las variables evaluadas (sexo, edad, raza, época del año y parámetros hematológicos); se analizaron mediante la prueba de independencia de Chi cuadrada con un nivel de significancia de 0.05; utilizando el programa estadístico MedCalc. V. 7.0.
RESULTADOS<bold>Presencia de <italic>E. canis</italic> y <italic>A. phagocytophilum</italic>
</bold>
Del número total de muestras analizadas (384) durante el periodo de estudio, 103 resultaron positivos a E. canis (frecuencia de 26.8 %) mediante la técnica de PCR, donde se amplificó el gen GltA con un tamaño molecular esperado de 200 pb, como se puede observar en la figura 1. De los frotis sanguíneos evaluados se logró identificar E. canis en sólo 41 de las muestras evaluadas (10.7%). Las mórulas se observaron en el citoplasma de linfocitos y monocitos como estructuras redondas, con un tamaño entre 4 a 6 µm de diámetro que se tiñeron fuertemente de un color basofílico; como se muestra en la figura 2. Por otro lado, ninguno de los perros evaluados por PCR o evaluación de frotis resultó positivo para A. phagocytophilum (figura 3).
<bold>Amplificación por PCR de <italic>E. canis</italic> en muestras de sangre tomada de caninos</bold>
(M) Marcador de peso molecular, (C+) control positivo con peso molecular de 200 pb, (115, 117,118, 119, 120, 121, 126) muestras positivas, (C-) control negativo con agua bidestilada. Gel de agarosa al 2%, teñido con Diamond.
Amplificación por PCR de <italic>A. phagocytophilum</italic> en muestras de sangre tomada de caninos
(M) Marcador de peso molecular, (C+) control positivo con peso molecular de 849 pb, (45-51) muestras negativas, (C-) control negativo con agua bidestilada. Gel de agarosa al 2%, teñido con Diamond.
Características de la población canina
Se evaluaron 192 hembras (50%) y 192 machos (50%), con edades comprendidas entre 3 meses hasta 20 años. Los resultados observados nos muestran que E. canis no distingue entre género; ya que dentro del grupo de infectados los porcentajes de hembras (29.7) y machos (24.0) no fueron estadísticamente significativos (p>0.05). Al evaluar la relación entre la edad del perro (cachorros, adultos o seniors) y el porcentaje de positivos a E. canis, se determinó que existe relación significativa entre ambas variables, donde la condición de adulto (1 a 7 años) está relacionada con la presencia de la enfermedad (p<0.05) (tabla 2).
Frecuencias y porcentajes de positivos y negativos a <italic>E. canis</italic> agrupados por característica del animal y época del año
Presencia de E. canis
Valor de p
Variable
Positivo Frecuencia
%
Negativo Frecuencia
%
Sexo
0.205
Macho
42
24.0
146
76.0
Hembra
57
29.7
135
70.3
Edad
0.016
Cachorro (0-12 meses)
16
22.2
56
77.8
Adulto (1 a 7 años)
69
32.5
143
67.5
Senior (>7 años)
18
18.0
82
82.0
Raza
0.981
Mestizo
19
26.0
54
74.0
De raza
84
27.0
227
73.0
Época del año
0.816
Primavera-Verano
71
26.3
199
73.7
Otoño-Invierno
32
28.1
82
71.9
Los perros de raza representaron el 81% (311/384) de la población de estudio y los mestizos constituyeron el 19% (73/384); sin embargo, la prueba de independencia de chi cuadrada no encontró diferencias estadísticas significativas entre el resultado positivo a E. canis, en relación con los grupos raciales definidos y los mestizos (p>0.05) (tabla 2). De la misma manera, no se encontraron diferencias significativas entre la presencia de Ehrlichiosis con la época del año (tabla 2).
Variables hematológicas
En relación con los hallazgos de laboratorio para los perros positivos a E. canis no existió diferencias significativas en aquellos que presentaban anemia, trombocitopenia o hiperproteinemia comparado con los animales negativos quienes muchos de ellos presentaban porcentajes parecidos al grupo de infectado (p>0.05). Por otro lado, sí se encontraron diferencias significativas para algunos parámetros de la serie blanca, como el recuento total de leucocitos y neutrófilos (p<0.05). Sin embargo, para estos analitos, la mayor cantidad de perros infectados con Ehrlichia fueron los que resultaron con valores dentro de los rangos de referencia, en comparación con los animales que resultaron negativos en donde se muestra una gran cantidad de perros con leucocitosis o neutrofilia. Para el resto de los parámetros hematológicos evaluados la prueba estadística no encontró diferencias significativas (p>0.05), como se observa en la tabla 3.
Frecuencias y porcentajes de positivos y negativos a <italic>E. canis</italic> agrupados en serie roja y plaquetas
Presencia de E. canis
Valor de p
Variable
Presencia de E. canis Positivo Frecuencia
%
Negativo Frecuencia
%
Hematocrito
0.280
Anemia (< 0.37 L/L)
49
24.3
153
75.7
Sin anemia (≥0.37 L/L)
54
29.7
128
70.3
Proteínas Plasmáticas
0.739
Sin hiperproteinemia (<75 g/L)
45
25.7
130
74.3
Con hiperproteinemia (>75 g/L)
58
27.8
209
72.2
Plaquetas
0.946
Trombocitopenia(<180X109/L)
6
28.6
15
71.4
Sin trombocitopenia (≥180X109/L)
97
26.7
266
73.3
Leucocitos
0.005
Leucopenia (<6x109/L)
3
15.8
16
84.2
Normal (6-17x 109/L)
71
33.3
142
66.7
Leucocitosis(>17x109/L)
29
19.1
123
80.9
Monocitos
0.060
Sin Monocitosis (≤1.4x109/L)
31
21.
116
78.9
Monocitosis(>1.4x109/L)
72
30.4
165
69.6
Linfocitos
0.235
Linfocitosis(>4.8x109/L)
12
18.5
53
81.5
Normal (1.0-4.8x109/L)
72
28.1
184
71.9
Linfopenia(<1.0x109/L)
19
30.2
44
69.8
Neutrófilos Segmentado
0.004
Neutropenia (<3.0 x109/L)
30
18.4
133
81.6
Normal (3.0-11.5x109/L)
70
33.8
137
66.2
Neutrofilia(>11.5x109/L)
3
21.4
11
78.6
Eosinófilos
0.575
Sin eosinofilia (<0.9x109/L)
90
26.2
253
73.8
Con Eosinofilia (>0.9x109/L)
13
31.7
28
68.3
DISCUSIÓN
Hoy en día, la ehrlichiosis y anaplasmosis canina han ganado mayor importancia a nivel
mundial, lo cual se atribuye principalmente a que su vector (Rhipicephalus
sanguineus) es considerado como la especie de garrapata con mayor
distribución geográfica (Aguiar et
al., 2007; Parola et
al., 2013; Cabezas-Cruz
et al., 2019). En este trabajo de investigación se
encontró que del número total de perros evaluados (384), 103 resultaron positivos a
E. canis (26.8 %) mediante la técnica de PCR y solamente 41
(10.7%) a través de la evaluación del frotis sanguíneo. Esta discrepancia de los 2
métodos utilizados es similar a lo reportado por Happi et al., (2018), quienes de un total de116
muestras de perros sólo 10.3% resultaron positivas por microscopía, comparada con la
técnica de PCR donde se obtuvo 42 resultados positivos (36.2%). Estos resultados
eran de esperarse, ya que aunque el diagnóstico por visualización microscópica de
las típicas inclusiones intracelulares o mórulas dentro del citoplasma de los
monocitos o linfocitos en extendidos de sangre periférica (figura 3), ha sido de
gran importancia; esta técnica presenta ciertas desventajas, como la falta de
sensibilidad durante la fase temprana de la infección, cuando existe una baja
bacteremia; o bien, cuando la bacteria se multiplica en microcolonias
intracitoplasmáticas en órganos linfoides donde adquirirá mecanismos que aseguren la
evasión de la respuesta inmune dentro de la célula del hospedero (Bai et al., 2017; Manasa et al. 2017; McClure et al., 2017; Tominello et al., 2019;Franco-Zetina et al., 2019).
Además, se han reportado falsos negativos en casos crónicos o transitorios, debido a
que las mórulas suelen desaparecer cinco a ocho días después de la infección, como
se ha revelado en estudios experimentales en perros y ganado (Gal et al., 2008; Stuen
et al., 2013).
En México, estas enfermedades frecuentemente son subdiagnosticadas, contando con pocos estudios que determinen su prevalencia. En el 2009 en Yucatán se registró una seroprevalencia de ehrlichiosis canina del 45% (Jiménez-Coello et al., 2009) y en otra investigación donde participaron 28 estados de la República Mexicana, donde se determinó la presencia de anticuerpos contra Anaplasma spp., Borrelia burgdorferi y E. canis; registrándose una alta prevalencia para E. canis (55%) y moderada para Anaplasma spp (16,4%), para algunos estados del noreste como Coahuila y Nuevo León (Movilla et al., 2016). Geográficamente los animales que participaron en este estudio pertenecen a la zona noreste de México; sin embargo, si comparamos la prevalencia obtenida en la zona centro de Tamaulipas para E. canis (26.8%) con estos dos estados, sería mucho menor. No obstante, es importante mencionar que en ese estudio se utilizaron pruebas serológicas, las cuales pueden tener el inconveniente de presentar reacción cruzada con otros microrganismos estrechamente relacionados; sobrestimando los resultados de prevalencia y planteando la necesidad de realizar estudios con técnicas moleculares que permitan evidenciar con mayor exactitud el tipo de patógeno implicado (Cetinkaya et al., 2016).
En el 2019, se realizó un estudio de detección molecular de E. canis en zonas rurales de Yucatán, encontrando un 29.26% de prevalencia (Ojeda-Chi et al., 2019), lo cual es cercano a lo reportado en este trabajo (26.8%); pero mucho mayor comparada con la prevalencia encontrada en perros evaluados en la Comarca Lagunera (4%) (Almazán et al., 2016).
En cuanto a las infecciones por A. phagocytophilum, se han diagnosticado cada vez más en animales de compañía y de granja a nivel mundial (McMahan et al., 2016). En México, A. phagocytophilum, se ha detectado en zarigüeyas y perros del estado de Campeche, con una prevalencia de 3 y 27%, respectivamente (Rojero et al., 2017); sin embargo, en este trabajo ninguno de los perros evaluados resultó positivo por PCR o frotis sanguíneo. Esto no es sorprendente, ya que Ixodes spp. y Dermacentor spp., garrapatas poco frecuentes en la zona de estudio, han sido reconocidas como los vectores de mayor importancia en el ciclo de transmisión de esta bacteria, lo cual pudo contribuir a su nula presencia (Tinoco-García et al., 2009; Guzmán-Cornejo et al., 2016; Rodríguez-Vivas et al. 2019).
Los resultados observados en esta investigación muestran que E. canis no tiene predilección entre género, ya que dentro del grupo de los infectados los porcentajes de hembras (29.7) y machos (24.0) no fueron estadísticamente significativos (p>0.005). Esta misma variable ha sido estudiada por varios autores (Nuñez, 2003; Rodríguez-Vivas et al., 2005), encontrando resultados similares. No obstante, esto discrepa de lo registrado por otros investigadores, donde sostienen que las hembras, especialmente durante el celo preñez o parto, favorecen el riesgo de contraer infecciones por E. canis (Salazar et al., 2014; Abdelfattah et al., 2021).
En relación con los hallazgos hematológicos asociados a la presencia de ehrlichiosis y anaplasmosis canina, se ha registrado que dichas alteraciones dependerán en qué fase de la enfermedad se encuentran (Afusat et al., 2020). Durante la etapa aguda es común la presencia de anemia, la cual suele ser leve a moderada (usualmente normocítica, normocrómica, no regenerativa) (Eberts et al., 2011).
En este trabajo, la presencia de anemia no se relacionó significativamente con ninguna de las enfermedades. La trombocitopenia ha sido un hallazgo hematológico que tradicionalmente ha sido asociado a la ehrlichiosis canina (Piratae et al., 2019). Sin embargo, en este estudio la presencia de trombocitopenia (<200,000) no tuvo asociación con los animales positivos a E. canis. Diversos estudios han reportado una asociación entre el número de plaquetas y la presencia de E. canis, particularmente en animales con recuento celular plaquetario inferior a 100 X109/L (Bulla et al., 2004; Tngsahuan et al.,2020). Aunque en este estudio se reportaron muchos animales con presencia de anemia e hiperproteinemia, no existe asociación estadística significativa al compararlos con animales que resultaron negativos; lo anterior puede deberse a la posible presencia de otros hemoparásitos como Ehrlichia ewingii o Anaplasma platys, los cuales pueden producir grados de anemia e hiperproteinemia similares a los reportados en perros infectados con E. canis (Piratae et al., 2019).
Por otro lado, es posible que muchos de los individuos positivos a E. canis con resultados hematológicos sin alteraciones, hubieran estado en la fase subclínica de la enfermedad; esto último sería de gran importancia ya que si la enfermedad no se detecta durante esta fase podría progresar a una etapa crónica, produciendo graves daños irreversibles como trombocitopenia, leucopenia y anemia severa no regenerativa producto de una supresión de la médula ósea (Little et al., 2014).
En cuanto a la evaluación de la serie blanca, se observa que a pesar de la existencia de diferencias significativas entre los casos negativos y positivos a E. canis para el conteo total de leucocitos, neutrófilos y monocitos; los resultados no eran lo esperado, ya que los perros negativos resultaron con más alteraciones en estas células (ya sea que estuvieran aumentadas o disminuidas), comparados con los positivos. Estos hallazgos concuerdan con los resultados obtenidos por Asgarali y colaboradores (2012), quienes reportaron que perros con Ehrlichiosis manifestaron niveles de neutrófilos y monocitos dentro de rangos de referencia; a diferencia de los animales negativos, los cuales tuvieron un aumento significativo en dichas células. Una posible explicación de por qué muchos de los perros positivos resultaran sin alteraciones en la serie blanca, es porque tal vez estos animales pudieron encontrarse en la fase subclínica de la enfermedad, donde la mayoría son asintomáticos y no presentan alteraciones hematológicas de consideración (de Castro et al., 2004).
CONCLUSIONES
El presente estudio evidenció que las alteraciones hematológicas evaluadas en perros con signología sospechosa a Ehrlichia canis resultaron no ser específicas, ya que una gran cantidad de estos animales no se encontraban infectados. Por otro lado, muchos de los perros que sí resultaron positivos, permanecieron sin cambios aparentes en sus hemogramas, lo cual es de gran relevancia, ya que estos individuos si no se diagnostican a tiempo podrían ser reservorios para otros hospedadores incluyendo el ser humano. Además, el clínico veterinario debería considerar que estas enfermedades pueden cursar por un cuadro subclínico sin signología o con la presencia de co-infecciones que produzcan signos similares, lo cual dificultarían su diagnóstico y por ende el tratamiento adecuado. Se sugieren realizar más investigaciones que incluyan la detección de otras especies de hemoparásitos en la región, debido a su importancia como agentes potencialmente zoonóticos.
AGRADECIMIENTOS
Al Proyecto PRODEP No. 511-6/2019.-13905 titulado “Evidencia molecular de patógenos transmitidos por garrapatas y su asociación con cambios hematológicos en caninos infectados naturalmente en Cd. Victoria, Tam., México” otorgado por el Fomento a la Generación y Aplicación Innovadora del Conocimiento (GAC) como parte del Apoyo a la reincorporación de Exbecario.
LITERATURA CITADAAbdelfattah S, Alanazi AD, Alireza S, Domenico O. 2021. Seroprevalence and associated risk factors for vector-borne pathogens in dogs from Egypt. Parasit Vectors. 14:175. https://doi.org/10.1186/s13071-021-04670-0AbdelfattahSAlanaziADAlirezaSDomenicoO.2021Seroprevalence and associated risk factors for vector-borne pathogens in dogs from EgyptParasit Vectors.1417517510.1186/s13071-021-04670-0Afusat JJ, Obokparo GO, Oluwafemi AA, Latifat AA. 2020. Haematology and serum chemistry in clinical canine ehrlichiosis. Vom Journal of Veterinary Science. 15(1):61-66. https://www.researchgate.net/publication/346785733AfusatJJObokparoGOOluwafemiAALatifatAA.2020Haematology and serum chemistry in clinical canine ehrlichiosisVom Journal of Veterinary Science1516166https://www.researchgate.net/publication/346785733Aguiar DM, Cavalcante GT, Pinter A, Gennari SM, Camargo LMA, Labruna MB. 2007. Prevalence of Ehrlichia canis (Rickettsiales: Anaplasmataceae) in dogs and Rhipicephalus sanguineus (Acari: Ixodidae) ticks from Brazil. Journal of Medical Entomology. 44:126-132. https://doi.org/10.1093/jmedent/41.5.126AguiarDMCavalcanteGTPinterAGennariSMCamargoLMALabrunaMB.2007Prevalence of Ehrlichia canis (Rickettsiales: Anaplasmataceae) in dogs and Rhipicephalus sanguineus (Acari: Ixodidae) ticks from BrazilJournal of Medical Entomology4412613210.1093/jmedent/41.5.126Allison RW, Little SE. 2013. Diagnosis of rickettsial diseases in dogs and cats. Veterinary Clinical Pathology. 42:127-144. https://doi.org/10.1111/vcp.12040AllisonRWLittleSE.2013Diagnosis of rickettsial diseases in dogs and catsVeterinary Clinical Pathology4212714410.1111/vcp.12040Almazán C, Gonzalez-Alvarez VH, de Mera IGF, Cabezas-Cruz A, Rodríguez-Martínez R, de la Fuente J. 2016. Molecular identification and characterization of Anaplasma platys and Ehrlichia canis in dogs in Mexico. Ticks and Tick-borne Diseases. 7:276-283. https://doi:10.1016/j.ttbdis.2015.11.002AlmazánCGonzalez-AlvarezVHde MeraIGFCabezas-CruzARodríguez-MartínezRde la FuenteJ.2016Molecular identification and characterization of Anaplasma platys and Ehrlichia canis in dogs in MexicoTicks and Tick-borne Diseases727628310.1016/j.ttbdis.2015.11.002Asgarali Z, Pargass I, Adam J, Mutani A, Ezeokoli. 2012. Haematological parameters in stray dogs seropositive and seronegative to Ehrlichia canis in North Trinidad. Ticks and Tick Borne Diseases. 3(4): 207-211. https://doi.org/10.1016/j.ttbdis.2012.03.006AsgaraliZPargassIAdamJMutaniAEzeokoli2012Haematological parameters in stray dogs seropositive and seronegative to Ehrlichia canis in North TrinidadTicks and Tick Borne Diseases3420721110.1016/j.ttbdis.2012.03.006Bai L, Goel P, Jhambh R, Kumar P, Joshi V G. 2017. Molecular prevalence and haemato- biochemical profile of canine monocytic ehrlichiosis in dogs in and around Hisar, Haryana, India. J Parasit Dis. 41(3): 647-54. https://doi.org/10.1007/s12639-016-0860-8BaiLGoelPJhambhRKumarPJoshiV G.2017Molecular prevalence and haemato- biochemical profile of canine monocytic ehrlichiosis in dogs in and around Hisar, Haryana, IndiaJ Parasit Dis41364765410.1007/s12639-016-0860-8Battilani M, De Arcangeli S, Balboni A, Dondi F. 2017. Genetic diversity and molecular epidemiology of Anaplasma. Infection Genetics and Evolution. 49:195-211. https://doi.org/10.1016/j.meegid.2017BattilaniMDe ArcangeliSBalboniADondiF.2017Genetic diversity and molecular epidemiology of AnaplasmaInfection Genetics and Evolution4919521110.1016/j.meegid.2017Beugnet F, Chalvet-Monfray K. 2013. Impact of climate change in the epidemiology of vector-borne diseases in domestic carnivores. Comp Immunol Microbiol Infect Dis. 36:559-566. https://doi.org/10.1016/j.cimid.2013.07.003BeugnetFChalvet-MonfrayK.2013Impact of climate change in the epidemiology of vector-borne diseases in domestic carnivoresComp Immunol Microbiol Infect Dis3655956610.1016/j.cimid.2013.07.003Bhadesiya CM, Modi DV. 2015. Correlation of epidemiology of Rhipicephalous sanguineus and canine ehrlichiosis in nine different localities of middle Gujarat. International Agricultural Science and Veterinary Medicine. 3(1): 2320-3730. http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.740.420&rep=rep1&type=pdfBhadesiyaCMModiDV.2015Correlation of epidemiology of Rhipicephalous sanguineus and canine ehrlichiosis in nine different localities of middle GujaratInternational Agricultural Science and Veterinary Medicine3123203730http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.740.420&rep=rep1&type=pdfBulla C, Kiomi R, Pessoa J, Trinca LA, Souza R, Wiedmeyer CE. 2004. The relationship between the degree of thrombocytopenia and infection with Ehrlichia canis in an endemic area. Veterinary Research. 35:141-146. https://doi.org/10.1051/VETRES:2003038BullaCKiomiRPessoaJTrincaLASouzaRWiedmeyerCE.2004The relationship between the degree of thrombocytopenia and infection with Ehrlichia canis in an endemic areaVeterinary Research3514114610.1051/VETRES:2003038Cabezas-Cruz A, Allain E, Ahmad AS, Saeed MA, Rashid I, Ashraf K, Estrada-Peña A. 2019. Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (sl). Parasites & Vectors. 12:12. https://doi.org/10.1186/s13071-018-3194-9Cabezas-CruzAAllainEAhmadASSaeedMARashidIAshrafKEstrada-PeñaA.2019Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (sl)Parasites & Vectors12121210.1186/s13071-018-3194-9Cetinkaya H, Matur E, Akyazi I, Ekiz EE, Aydin L, Toparlak M. 2016. Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of Turkey. Ticks and Tickborne Diseases. 7:706-714. https://doi.org/10.1016/j.ttbdis.2016.02.021CetinkayaHMaturEAkyaziIEkizEEAydinLToparlakM.2016Serological and molecular investigation of Ehrlichia spp. and Anaplasma spp. in ticks and blood of dogs, in the Thrace Region of TurkeyTicks and Tickborne Diseases770671410.1016/j.ttbdis.2016.02.021De Castro MB, Machado RZ, de Aquino LP, Alessi AC, Costa MT. 2004. Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findings. Vet Parasitol. 119:73-86. https://doi.org/10.1016/J.VETPAR.2003.10.012De CastroMBMachadoRZde AquinoLPAlessiACCostaMT.2004Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findingsVet Parasitol119738610.1016/J.VETPAR.2003.10.012De la Fuente J, Antunes S, Bonnet S, Cabezas-Cruz A, Domingos AG, Estrada-Peña A, et al. 2017. Tick-pathogen interactions and vector competence: identification of molecular drivers for tick-borne diseases. Frontiers in cellular and infection microbiology. 7:114. https://doi.org/10.3389/fcimb.2017.00114De la FuenteJAntunesSBonnetSCabezas-CruzADomingosAGEstrada-PeñaA2017Tick-pathogen interactions and vector competence: identification of molecular drivers for tick-borne diseasesFrontiers in cellular and infection microbiology711410.3389/fcimb.2017.00114Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rurangirwa FR. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and HGE agent as subjective synonyms of Ehrlichia phagocytophila. International Journal of Systematic and Evolutionary Microbiology. 51(6):2145-2165. https://doi.org/10.1099/00207713-51-6-2145DumlerJSBarbetAFBekkerCPDaschGAPalmerGHRaySCRurangirwaFR.2001Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and HGE agent as subjective synonyms of Ehrlichia phagocytophilaInternational Journal of Systematic and Evolutionary Microbiology5162145216510.1099/00207713-51-6-2145EberTS MD, Vissotto de Paiva Diniz PP, Beall MJ, Stillman BA, Chandrashekar R, Breitschwerdt EB. 2011. Typical and atypical manifestations of Anaplasma phagocytophilum infection in dogs. Journal of the American Animal Hospital Association. 47:86-94. https://doi.org/10.5326/JAAHA-MS-5578EberTSMDVissotto de Paiva DinizPPBeallMJStillmanBAChandrashekarRBreitschwerdtEB.2011Typical and atypical manifestations of Anaplasma phagocytophilum infection in dogsJournal of the American Animal Hospital Association47869410.5326/JAAHA-MS-5578Farhan AA. 2015. Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significance. Parasitol Res. 114(11):3941-57. https://doi.org/10.1007/s00436-015-4698-2FarhanAA.2015Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significanceParasitol Res114113941395710.1007/s00436-015-4698-2Franco-Zetina M, Adame-Gallegos J, Dzul-Rosado K. 2019. Effectivity of diagnostic methods for the detection of human and canine monocytic ehrlichiosis. Rev. Chilena Infectol. 36(5):650-655. https://doi.org/10.4067/S0716-10182019000500650Franco-ZetinaMAdame-GallegosJDzul-RosadoK.2019Effectivity of diagnostic methods for the detection of human and canine monocytic ehrlichiosisRev. Chilena Infectol36565065510.4067/S0716-10182019000500650Gal A, Loeb E, Yisaschar-Mekuzas Y, Baneth G. 2008. Detection of Ehrlichia canis by PCR in different tissues obtained during necropsy from dogs surveyed for naturally occurring canine monocytic ehrlichiosis. Veterinary Journal. 175:212-217. https://doi.org/10.1016/J.TVJL.2007.01.013GalALoebEYisaschar-MekuzasYBanethG.2008Detection of Ehrlichia canis by PCR in different tissues obtained during necropsy from dogs surveyed for naturally occurring canine monocytic ehrlichiosisVeterinary Journal17521221710.1016/J.TVJL.2007.01.013Guzmán-Cornejo C, Robbins RG, Guglielmone AA, Montiel-Parra G, Rivas G, Pérez TM. 2016. The Dermacentor (Acari, Ixodida, Ixodidae) of Mexico: hosts, geographical distribution and new records. ZooKeys. 569:1-22. https://doi.org/10.3897/zookeys.569.7221Guzmán-CornejoCRobbinsRGGuglielmoneAAMontiel-ParraGRivasGPérezTM.2016The Dermacentor (Acari, Ixodida, Ixodidae) of Mexico: hosts, geographical distribution and new recordsZooKeys56912210.3897/zookeys.569.7221Happi AN, Toepp AJ, Ugwu CA, Petersen CA, Sykes JE. 2018. Detection and identification of blood-borne infections in dogs in Nigeria using light microscopy and the polymerase chain reaction. Vet Parasitol Reg Stud Reports. 11: 55-60. https://doi.org/10.1016/j.vprsr.2017.12.002HappiANToeppAJUgwuCAPetersenCASykesJE.2018Detection and identification of blood-borne infections in dogs in Nigeria using light microscopy and the polymerase chain reactionVet Parasitol Reg Stud Reports11556010.1016/j.vprsr.2017.12.002Harrus S, Waner T. 2011. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): an overview. The Veterinary Journal. 187:292-296. https://doi.org/10.1016/j.tvjl.2010.02.001HarrusSWanerT.2011Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): an overviewThe Veterinary Journal18729229610.1016/j.tvjl.2010.02.001Irwin PJ. 2014. It shouldn’t happen to a dog … or a veterinarian: clinical paradigms for canine vector-borne diseases. Trends Parasitology 30:104-12. https://doi.org/10.1016/j.pt.2013.12.001IrwinPJ.2014It shouldn’t happen to a dog … or a veterinarian: clinical paradigms for canine vector-borne diseasesTrends Parasitology3010411210.1016/j.pt.2013.12.001Ismail N, McBride JW. 2017. Tick-borne emerging infections: ehrlichiosis and anaplasmosis. Clinics in Laboratory Medicine. 37:317-340. https://doi.org/10.1016/j.cll.2017.01.006IsmailNMcBrideJW.2017Tick-borne emerging infections: ehrlichiosis and anaplasmosisClinics in Laboratory Medicine3731734010.1016/j.cll.2017.01.006Jiménez-Coello M, Pérez-Osorio C, Vado-Solís I, Rodríguez-Buenfil JC, Ortega- Pacheco A. 2009. Serological survey of Ehrlichia canis in stray dogs from Yucatan, Mexico, using two different diagnostic tests. Vector Borne Zoonotic Diseases. 9:209-212. https://doi.org/10.1089/vbz.2008.0039Jiménez-CoelloMPérez-OsorioCVado-SolísIRodríguez-BuenfilJCOrtega- PachecoA.2009Serological survey of Ehrlichia canis in stray dogs from Yucatan, Mexico, using two different diagnostic testsVector Borne Zoonotic Diseases920921210.1089/vbz.2008.0039Little E, Beall MJ, Bowman DD, Chandrashekar R, Stamaris J. 2014. Canine infection with Dirofilaria immitis, Borrelia burgdorferi, Anaplasma spp., and Ehrlichia spp. in the United States, 2010-2012. Parasites & Vectors. 7:1-9. https://parasitesandvectors.biomedcentral.com/articles/10.1186/1756-3305-7-257LittleEBeallMJBowmanDDChandrashekarRStamarisJ.2014Canine infection with Dirofilaria immitis, Borrelia burgdorferi, Anaplasma spp., and Ehrlichia spp. in the United States, 2010-2012Parasites & Vectors719https://parasitesandvectors.biomedcentral.com/articles/10.1186/1756-3305-7-257Maggi RG, Krämer F. 2019. A review on the occurrence of companion vector-borne diseases in pet animals in Latin America. Parasitic Vectors. 12:145. doi: 10.1186/s13071-019-3407-xMaggiRGKrämerF.2019A review on the occurrence of companion vector-borne diseases in pet animals in Latin AmericaParasitic Vectors.1214514510.1186/s13071-019-3407-xManasa RK, Pritpal SD, Lachhman DS, Baljinder KB, and Sanjeev KU. 2017. Clinical and hematobiochemical response in canine monocytic ehrlichiosis seropositive dogs of Punjab. Veterinary World. 10(2): 255-261. https://doi.org/10.14202/vetworld.2017.255-261ManasaRKPritpalSDLachhmanDSBaljinderKBSanjeevKU.2017Clinical and hematobiochemical response in canine monocytic ehrlichiosis seropositive dogs of PunjabVeterinary World.10225526110.14202/vetworld.2017.255-261McClure EE, Chávez ASO, Shaw DK, Carlyon JA, Ganta RR, Noh SM, Wood DO, Ba voil PMA, Brayton KA, Martinez JJ, McBride JW, Valdivia RH, Munderloh UG, Pedra JHF. 2017. Engineering of obligate intracellular bacteria: progress, challenges and paradigms. Nat Rev Microbiol. 15:544-558. https://doi.org/10.1038/nrmicro.2017.59McClureEEChávezASOShawDKCarlyonJAGantaRRNohSMWoodDOBa voilPMABraytonKAMartinezJJMcBrideJWValdiviaRHMunderlohUGPedraJHF.2017Engineering of obligate intracellular bacteria: progress, challenges and paradigmsNat Rev Microbiol1554455810.1038/nrmicro.2017.59McMahan CS, Wang D, Beall MJ, Bowman DD, Little SE, Pithua PO, Julia L, Sharp JL, Stich RW, Yabsley MJ, Lund RB. 2016. Factors associated with Anaplasma spp. seroprevalence among dogs in the United States. Parasites & Vectors. 9:169. https://doi.org/10.1186/s13071-016-1431-7McMahanCSWangDBeallMJBowmanDDLittleSEPithuaPOJuliaLSharpJLStichRWYabsleyMJLundRB.2016Factors associated with Anaplasma spp. seroprevalence among dogs in the United StatesParasites & Vectors916910.1186/s13071-016-1431-7Movilla R, García C, Siebert S, Roura X. 2016. Countrywide serological evaluation of canine prevalence for Anaplasma spp., Borrelia burgdorferi (sensu lato), Dirofilaria immitis and Ehrlichia canis in Mexico. Parasites & Vectors. 9:421. https://doi.org/10.1186/s13071-016-1686-zMovillaRGarcíaCSiebertSRouraX.2016Countrywide serological evaluation of canine prevalence for Anaplasma spp., Borrelia burgdorferi (sensu lato), Dirofilaria immitis and Ehrlichia canis in MexicoParasites & Vectors942142110.1186/s13071-016-1686-zNúñez OL. 2003. Estudio de la seroprevalencia de Ehrlichia canis en México. Asociación Méxicana de Médicos Veterinarios Especialistas en Pequeñas Especies. 14:83-85. https://www.researchgate.net/publication/291003826NúñezOL.2003Estudio de la seroprevalencia de Ehrlichia canis en MéxicoAsociación Méxicana de Médicos Veterinarios Especialistas en Pequeñas Especies148385https://www.researchgate.net/publication/291003826Ojeda-Chi MM, Rodriguez-Vivas RI, Esteve-Gasent MD, Pérez de León A, Modarelli JJ, Villegas-Perez SL. 2019. Ehrlichia canis in dogs of Mexico: Prevalence, incidence, co- infection and factors associated. Comparative Immunology, Microbiology and Infectious Diseases. 67:101351. https://doi.org/10.1016/j.cimid.2019.101351Ojeda-ChiMMRodriguez-VivasRIEsteve-GasentMDPérez de LeónAModarelliJJVillegas-PerezSL.2019Ehrlichia canis in dogs of Mexico: Prevalence, incidence, co- infection and factors associatedComparative Immunology, Microbiology and Infectious Diseases6710135110135110.1016/j.cimid.2019.101351Parola P, Paddock CD, Socolovschi C, Labruna MB, Mediannikov O, Kernif T, et al. 2013. Update on tick-borne rickettsioses around the world: a geographic approach. Clin Microbiol Rev. 26:657-702. https://doi.org/10.1128/CMR.00032-13ParolaPPaddockCDSocolovschiCLabrunaMBMediannikovOKernifT2013Update on tick-borne rickettsioses around the world: a geographic approachClin Microbiol Rev2665770210.1128/CMR.00032-13Piratae S, Senawong P, Chalermchat P, Harnarsa W, Sae-chue B. 2019. Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in Kalasin. Thailand. Veterinary World. 12:131. https://doi.org/10.14202/vetworld.2019.131-135PirataeSSenawongPChalermchatPHarnarsaWSae-chueB.2019Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in KalasinThailand. Veterinary World1213113110.14202/vetworld.2019.131-135Rodríguez-Vivas RI, Albornoz REF, Bolio GME. 2005. Ehrlichia canis in dogs in Yucatan, Mexico: seroprevalence, prevalence of infection and associated factors. Veterinary Parasitology. 127:75-79. https://doi.org/10.1016/J.VETPAR.2004.08.022Rodríguez-VivasRIAlbornozREFBolioGME.2005Ehrlichia canis in dogs in Yucatan, Mexico: seroprevalence, prevalence of infection and associated factorsVeterinary Parasitology127757910.1016/J.VETPAR.2004.08.022Rodríguez-Vivas RI, Ojeda-Chi MM, Bolio-González ME, Rosado-Aguilar JA. 2019. Las garrapatas como vectores de enfermedades zoonóticas en México. Bioagrociencias. 12(1):19-26. https://www.revista.ccba.uady.mx/ojs/index.php/BAC/article/view/2993Rodríguez-VivasRIOjeda-ChiMMBolio-GonzálezMERosado-AguilarJA.2019Las garrapatas como vectores de enfermedades zoonóticas en MéxicoBioagrociencias1211926https://www.revista.ccba.uady.mx/ojs/index.php/BAC/article/view/2993Rojero-Vázquez R, Gordillo-Pérez G, Weber M. 2017. Infection of Anaplasma phagocytophilum and Ehrlichia spp. in opossums and dogs in Campeche, Mexico: the role of tick infestation. Frontiers in Ecology Evolution. 5:161. https://doi.org/10.3389/fevo.2017.00161Rojero-VázquezRGordillo-PérezGWeberM.2017Infection of Anaplasma phagocytophilum and Ehrlichia spp. in opossums and dogs in Campeche, Mexico: the role of tick infestationFrontiers in Ecology Evolution516116110.3389/fevo.2017.00161Salazar H, Edwin F, Buriticá EF, Echeverry DF, Barbosa I. 2014. Seroprevalencia de Ehrlichia canis y su relación con algunos parámetros clínicos y hematológicos en caninos admitidos en clínicas veterinarias de la ciudad de Ibagué (Colombia). Revista Colombiana de Ciencia Animal. 7 (1):56-63. http://revistas.ut.edu.co/index.php/ciencianimal/article/view/542SalazarHEdwinFBuriticáEFEcheverryDFBarbosaI.2014Seroprevalencia de Ehrlichia canis y su relación con algunos parámetros clínicos y hematológicos en caninos admitidos en clínicas veterinarias de la ciudad de Ibagué (Colombia)Revista Colombiana de Ciencia Animal715663http://revistas.ut.edu.co/index.php/ciencianimal/article/view/542Stich RW, Rikihisa Y, Ewing SA, Needham GR, Grover DL, Jittapalapong S. 2002. Detection of Ehrlichia canis in canine carrier blood and in individual experimentally infected ticks with a p30-based PCR assay. Journal of Clinical Microbiology. 40:540-546. https://doi.org/10.1128/JCM.40.2.540-546.2002StichRWRikihisaYEwingSANeedhamGRGroverDLJittapalapongS.2002Detection of Ehrlichia canis in canine carrier blood and in individual experimentally infected ticks with a p30-based PCR assayJournal of Clinical Microbiology4054054610.1128/JCM.40.2.540-546.2002Stuen S, Granquist EG. Silaghi C. 2013. Anaplasma phagocytophilum a widespread multi-host pathogen with highly adaptive strategies. Frontiers in Cellular and Infection Microbiology. 3:31. https://doi.org/10.3389/fcimb.2013.00031StuenSGranquistEGSilaghiC.2013Anaplasma phagocytophilum a widespread multi-host pathogen with highly adaptive strategiesFrontiers in Cellular and Infection Microbiology33110.3389/fcimb.2013.00031Tinoco-Gracia L, Quiroz-Romero H, Quintero-Martinez MT, Renteria-Evangelista TB, Gonzalez-Medina Y, Barreras-Serrano A, et al. 2009. Prevalence of Rhipicephalus sanguineus ticks on dogs in a region on the Mexico-USA border. Veterinary Record. 164:59-61. https://doi.org/10.1136/vr.164.2.59Tinoco-GraciaLQuiroz-RomeroHQuintero-MartinezMTRenteria-EvangelistaTBGonzalez-MedinaYBarreras-SerranoA2009Prevalence of Rhipicephalus sanguineus ticks on dogs in a region on the Mexico-USA borderVeterinary Record164596110.1136/vr.164.2.59Tominello TR, Oliveira ERA, Hussain SS, Wells AEJ, Golden B, Ismail N. 2019. Emerging roles of autophagy and inflammasome in ehrlichiosis. Front Immunol. 10:1011. https://doi.org/10.3389/fimmu.2019.01011TominelloTROliveiraERAHussainSSWellsAEJGoldenBIsmailN.2019Emerging roles of autophagy and inflammasome in ehrlichiosisFront Immunol101011101110.3389/fimmu.2019.01011Tngsahuan S, Chethanond U, Wasiksiri S, Saechan V, Thongtako W, Musikacharoen T. 2020. Hematological profile of blood parasitic infected dogs in Southern Thailand. Vet World. 13(11): 2388-2394. https://doi.org/10.14202/vetworld.2020.2388-2394TngsahuanSChethanondUWasiksiriSSaechanVThongtakoWMusikacharoenT.2020Hematological profile of blood parasitic infected dogs in Southern ThailandVet World131123882394/10.14202/vetworld.2020.2388-2394Vieira RFDC, Vieira TSWJ, Nascimento, DDAG, Martins TF, Krawczak FS, Labruna MB, Vidotto O. 2013. Serological survey of Ehrlichia species in dogs, horses, and humans: zoonotic scenery in a rural settlement from southern Brazil. Revista do Instituto de Medicina Tropical de São Paulo. 55:335-340. https://doi.org/10.1590/S0036-46652013000500007VieiraRFDCVieiraTSWJNascimentoDDAGMartinsTFKrawczakFSLabrunaMBVidottoO.2013Serological survey of Ehrlichia species in dogs, horses, and humans: zoonotic scenery in a rural settlement from southern BrazilRevista do Instituto de Medicina Tropical de São Paulo5533534010.1590/S0036-46652013000500007Wayne WD, Chad LC. 2013. Biostatistics: A Foundation for Analysis in the Health Sciences. 10th Edition Wiley. Pp. 191. ISBN 978-1-118-30279-8.WayneWDChadLC.2013Biostatistics: A Foundation for Analysis in the Health Sciences10Edition Wiley191191978-1-118-30279-8Yousefi A, Chaechi Nosrati MR, Golmohammadi A, Azami S. 2019. Molecular Detection of Anaplasma Phagocytophilum as a Zoonotic Agent in Owned and Stray Dogs in Tehran, Iran. Archives of Razi Institute. 74:33-38. https://doi.org/10.22092/ARI.2018.114893.1142YousefiAChaechi NosratiMRGolmohammadiAAzamiS.2019Molecular Detection of Anaplasma Phagocytophilum as a Zoonotic Agent in Owned and Stray Dogs in Tehran, IranArchives of Razi Institute74333810.22092/ARI.2018.114893.1142
Clave: e2021-21.
Original ArticleMolecular detection of Ehrlichia canis and Anaplasma phagocytophilum and hematological changes of infected dogsABSTRACT:
Ehrlichiosis and anaplasmosis are tick-borne diseases caused by bacteria of the genera Ehrlichia and Anaplasma. Since clinical manifestations are varied and nonspecific, the diagnosis in clinical practice, remains a challenge for veterinarians. Furthermore, the distribution of these infections includes areas where its tick vector, Rhipicephalus sanguineus is present. This study was designed to evaluate the prevalence and factors associated with the presence of Ehrlichia canis and Anaplasma phagocytophilum in dogs from the central area of Tamaulipas. PCR screened 384 canine blood samples obtained from different veterinary clinics and a shelter. The data were analyzed using the Chi-square test (P level <0.05 for statistical significance). The results showed that 103 (26.8%) out of 384 samples were positive for E. canis, while A. phagocytophilum was not detected. Statistical analysis did not show relationship between E. canis and variables like gender, breed, and origin (P˃0.05). Nonetheless, there was a statistically significant difference between infected adult dogs (15-84 months) compared to other age groups evaluated (p<0.05). Regarding hematocrit, platelets count, plasma protein, total and differential white blood cells counts, none of these parameters were significantly different (P>0.05).
Ehrlichiosis and anaplasmosis are diseases of great importance for both veterinary and public health, as they are responsible for diseases such as Monocytic Ehrlichiosis and Human Granulocytic Anaplasmosis (Vieira et al., 2013; Farhan 2015; Rodríguez-Vivas et al., 2019). Gram-negative obligate intracellular bacteria cause them. They are known as Ehrlichia spp and Anaplasma spp respectively (Harrus and Waner 2011; Stuen et al., 2013). Worldwide, cases have increased considerably in recent years mainly in tropical and subtropical areas where tick vectors (Ripicephalus sanguineus and Ixodes spp) proliferate (Beugnet and Chalvet-Monfray 2013;Irwin 2014;Little et al., 2014;Battilani et al., 2017). Due to the increasing proximity of people to their pets, the likelihood of bites by these ectoparasites is increasing considerably leading to these infections becoming reemerging zoonoses (Bhadesiya and Modi 2015;Ismail and McBride 2017).
In Mexico, canine Ehrlichiosis was reported for the first time in 1996, since then the number of cases has increased considerably (Maggi and Krämer 2019); however, the diagnosis, in many occasions is based on clinical signs without performing laboratory tests that directly or indirectly corroborate its presence. Definitive diagnosis focuses on microscopic techniques; however, these methods have low sensitivity and specificity in patients with low bacteremia, which prevents establishing adequate therapeutics (Harrus and Waner 2011;Allison and Little 2013). In response to this, Polymerase Chain Reaction (PCR) emerges as an important tool to support conventional diagnostic methods (Almazan et al., 2016;Cetinkaya et al., 2016;de la Fuente et al., 2017).
Tamaulipas state due to its geographical location has ideal characteristics that favor the development of ticks vectoring these diseases (Tinoco-Gracia et al., 2009); however, the true magnitude of this problem is unknown. Therefore, the main objective of this research was to determine the presence of E. canis and A. phagocytophilum, through PCR, in naturally infected dogs in the central zone of Tamaulipas; as well as to evaluate some factors associated with the presence of these diseases.
MATERIAL AND MÉTODOSStudy area
The present work was carried out with blood samples from dogs submitted (during the period March 2020 to March 2021) to the Laboratory of Parasitology and Clinical Analysis of the Faculty of Veterinary Medicine and Zootechnics "Dr. Norberto Treviño Zapata", belonging to the Autonomous University of Tamaulipas. Also, samples from several private veterinary clinics in the capital of Tamaulipas and some surrounding municipalities.
Study population
A non-probabilistic sampling was used. Samples from patients referred with the following inclusion criteria were analyzed: 1) being from Tamaulipas state (central zone), 2) presenting clinical signs related to hemoparasites (fever, diarrhea, uveitis, petechiae, epistaxis, osteoarticular, and respiratory, reproductive and neurological disorders), 3) presenting or having been in contact with ticks, and 4) having the consent of the pet owner. The sample size was 384 animals, which is the minimum sample size obtained from the formula of (n) for infinite population proportions, since there is no canine population census in the area to be evaluated (Wayne and Chad 2013). All dogs were handled according to the official animal welfare standards established by the Bioethics Committee of the Faculty of Veterinary Medicine and Zootechnics of the Autonomous University of Tamaulipas.
Sample collection
A minimum of 3 ml of blood was obtained by venous puncture (cephalic vein), which were rapidly transferred to a tube (BD Vacutainer®) with EDTA K2 (ethylenediaminetetraacetic acid potassium) anticoagulant. Samples were kept refrigerated (8°C) for no more than 24 hours before processing for hematological evaluation. An aliquot of blood was saved in 1.5 ml vials and was stored at -20°C for subsequent DNA extraction and PCR testing. In all cases, the age, sex, pedigree and season of the year in which the sample was taken from the individuals studied were recorded.
Hematological analysis
The determination of hematological parameters was performed immediately, within 4 hours of blood collection to avoid morphological alterations of cells. The samples were analyzed in an automated equipment (Auto Hematology Analyzer, MINDRAY, BC-2800 Vet; Shenzhen, China). For the determination of plasma proteins, the microhematocrit method was used, using capillary tubes without heparin; which were filled with – parts with blood, sealed and centrifuged (centrifuge KHT-410E Kendal Import S.A.C Gemmy Taiwan) at 11,500 rpm for 5 min. The plasma obtained was placed in a refractometer (American Optical) and total proteins were obtained. The leukocyte differential count was performed manually. The first consisted of assessing and counting in a blood smear (stained with Diff-Quik™) 100 nucleated cells and thus obtaining the percentage count of the different leukocytes: neutrophils, eosinophils, lymphocytes, monocytes and basophils. To determine whether anaemia was present, the hematocrit value was taken into account, which was categorized into 2 groups, with and without the presence of anaemia. The platelet count and total protein were divided into 2 groups, animals with and without thrombocytopenia and with and without the presence of hyperproteinemia, respectively. Total leukocytes as well as their different populations were grouped as normal, high and decreased counts.
Identification of hemoparasites by microscopy
For the search for hemoparasites by microscopy, blood smears were prepared, fixed with methanol for 5 minutes and stained with 10% Giemsa solution for 15 min. Subsequently, multiple random areas of the monolayer and tail of the smear were evaluated under the microscope with the immersion objective (100x); here we looked for the presence of morulae (cytoplasmic aggregates of basophilic color) or any other inclusion body compatible with hemoparasites (Dulmer et al., 2001).
MOLECULAR ANALYSISObtaining nucleic acids
From the stored EDTA blood aliquots, DNA extractions were performed using the commercial DNA extraction and purification kit (Wizard® Genomic DNA Purification- Promega), according to the protocols established by the company. The total DNA extracted was quantified, using a spectrophotometer (NanoDrop2000®, Thermo Scientific, Waltham, MA, USA) and stored at -20 °C until further use in PCR assays.
Polymerase Chain Reaction
For molecular analysis, a region of the GltA gene (used for identification of rickettsiae coding for the enzyme citrate synthase) for E. canis and a region of the Msp4 gene (major surface complex) for A. phagocytophilum were amplified. The GoTaq® Green Master Mix kit (Promega, Madison, WI USA. Cat. Num: M7122) was used according to protocols established by the company. For this, 21 µl of kit solution, 1 µl of sense primer, 1 µl of antisense primer and 2 µl of DNA from each sample were used to reach a final volume of 25 µl. The samples were then amplified in the thermal cycler (Applied Biosystems™ Num: 2720) with the amplification protocol shown in Table 1. The amplified products were analyzed by 2% agarose gel electrophoresis in 600 ml TAE Buffer, 1X (Promega, Madison, WI USA. Cat. Num: V4271) at 120 V for 40 min using the nucleic acid dye Diamond Nucleic Acid Dye (Promega, Madison, WI USA. Cat.Num: H1181) and subsequently visualized under UV light from the UVP transilluminator (Ultraviolet Products, Inc., California, USA. Cat. Num: TFM-30). DNA fragments of known lengths (E. canis, 200 bp; A. phagocytophilum: 980 bp) and a 100 bp DNA Ladder molecular weight marker (Promega, Madison, WI USA. Cat. Num: G210A) were used as a positive control for reference.
Sequence of oligonucleotides used for each pathogen, amplification protocol and size of amplified
Organism and target gene
Oligonucleotide sequence (5'-3')
Amplification
program
Amplified
size (bp)
Reference
E. canis Fw
95°C for 5 min
E. canis
ATAAACACGCTGACTTTACTGTTCC
94°C for 30 s 60 °C for 30 s
200
Stich et al., 2002
(GltA)
E canis Rev
72 °C for 1 min
GTGATGAGATAGAGCGCAGTACC
72 °C for 7 min
35 cycles
A. phagocytophilum
MSP4AP5 ATGAATTACAGAGAATTGCTTGTAGG
94°C for 5 min 94°C for 30 s 50 °C for 30 s
849
Yousefi et al., 2019
(Msp4)
MSP4AP3 TTAATTGAAAGCAAATCTTGCTCCTATG
72 °C for 30 s 72 °C for 7 min 35 cycles
Statistical analysis
Absolute frequencies and percentages of positive cases and hematological findings were represented. The degree of association between the presence of pathogens and the variables evaluated (sex, age, pedigree, time of year and hematological parameters) were analyzed by the Chi-square test of independence with a significance level of 0.05, using the statistical program MedCalc. V. 7.0.
RESULTS<bold>Presence of <italic>E. canis</italic> and <italic>A. phagocytophilum</italic>
</bold>
From the total number of samples analyzed (384) during the study period, 103 were positive for E. canis (frequency of 26.8%) by PCR technique, where the GltA gene was amplified with an expected molecular size of 200 bp, as shown in Figure 1. From the blood, smears evaluated, E. canis was identified in only 41 of the samples evaluated (10.7%). Morulae were observed in the cytoplasm of lymphocytes and monocytes as round structures, with a size between 4 to 6 µm in diameter that stained strongly basophilic in color; as shown in Figure 2. On the other hand, none of dogs evaluated by PCR or smear evaluation was positive for A. phagocytophilum (Figure 3).
PCR amplification of <italic>E. canis</italic> in blood samples taken from canines
M) Molecular weight primer, (C+) positive control with 200 bp molecular weight, (115, 117,118, 119, 120, 121, 126) positive samples, (C-) negative control with double distilled water. 2% agarose gel, stained with Diamond.
<bold>Lymphocyte in peripheral blood of a canine infected with an <italic>E. canis</italic> morula (arrow). Giemsa stain 10%</bold>
PCR amplification of <italic>A. phagocytophilum</italic> in blood samples taken from canines
(M) Molecular weight primer, (C+) positive control with molecular weight of 849 bp, (45-51) negative samples, (C-) negative control with double distilled water. 2% agarose gel, stained with Diamond.
Characteristics of the dog population
A number of 192 females (50%) and 192 males (50%), ranging in age from 3 months to 20 years, were evaluated. The observed results show that E. canis does not distinguish between genders, since within the infected group the percentages of females (29.7) and males (24.0) were not statistically significant (p>0.05). When evaluating the relationship between dog age (puppies, adults or seniors) and the percentage of E. canis positives, it was determined that there is a significant relationship between both variables, where the adult condition (1 to 7 years) is related to the presence of the disease (p<0.05) (Table 2).
Frequencies and percentages of <italic>E. canis</italic> positives and negatives grouped by animal characteristic and season of year
Presence of E. canis
Value of p
Variable
Positive Frequency
%
Negative Frequency
%
Sex
0.205
Male
42
24.0
146
76.0
Female
57
29.7
135
70.3
Age
0.016
Puppy (0-12 months)
16
22.2
56
77.8
Adult (1 a 7 years)
69
32.5
143
67.5
Senior (>7 years)
18
18.0
82
82.0
Breed
0.981
Crossbreed
19
26.0
54
74.0
Pedigree
84
27.0
227
73.0
Season of year
0.816
Spring-Summer
71
26.3
199
73.7
Fall-Winter
32
28.1
82
71.9
Pedigreed dogs represented 81% (311/384) of the study population and crossbreed constituted 19% (73/384); however, the chi-square test of independence found no significant statistical difference between E. canis positive result, in relation to the defined racial groups and crossbreed (p>0.05) (table 2). Similarly, no significant differences were found between the presence of Ehrlichiosis and the year season (Table 2).
Hematological variables
In relation to laboratory findings for E. canis positive dogs, there were no significant differences in those showing anaemia, thrombocytopenia or hyperproteinemia compared to negative animals, many of which presented percentages similar to the infected group (p>0.05). On the other hand, significant differences were found for some white blood cell parameters, such as total leukocyte and neutrophil counts (p<0.05). However, for these analytes, the greater number of dogs infected with Ehrlichia were those that resulted with values within the reference ranges, in comparison with the animals that resulted negative where a large number of dogs with leukocytosis or neutrophilia are shown. For the rest of the hematological parameters evaluated, the statistical test did not find significant differences (p>0.05), as shown in Table 3.
Frequencies and percentages of <italic>E. canis</italic> positives and negatives grouped in red series and platelets
Presence of E. canis
Value of p
Variable
Positive Frequency
%
Negative Frequency
%
Hematocrit
0.280
Anaemia (< 0.37 L/L)
49
24.3
153
75.7
Without anaemia (≥0.37 L/L)
54
29.7
128
70.3
Plasma Proteins
0.739
Without hyperproteinemia (<75 g/L)
45
25.7
130
74.3
With hyperproteinemia (>75 g/L)
58
27.8
209
72.2
Platelets
0.946
Thrombocytopenia (<180X109/L)
6
28.6
15
71.4
Without thrombocytopenia (≥180X109/L)
97
26.7
266
73.3
Leukocytes
0.005
Leukopenia (<6x109/L)
3
15.8
16
84.2
Normal (6-17x 109/L)
71
33.3
142
66.7
Leukocytosis (>17x109/L)
29
19.1
123
80.9
Monocytes
0.060
Without Monocytosis (≤1.4x109/L)
31
21.1
116
78.9
Monocytosis (>1.4x109/L)
72
30.4
165
69.6
Lymphocytes
0.235
Lymphocytosis (>4.8x109/L)
12
18.5
53
81.5
Normal (1.0-4.8x109/L)
72
28.1
184
71.9
Lymphopenia (<1.0x109/L)
19
30.2
44
69.8
Segmented Neutrophils
0.004
Neutropenia (<3.0 x109/L)
30
18.4
133
81.6
Normal (3.0-11.5x109/L)
70
33.8
137
66.2
Neutrophilia (>11.5x109/L)
3
21.4
11
78.6
Eosinophils
0.575
Without eosinophilia (<0.9x109/L)
90
26.2
253
73.8
With eosinophilia (>0.9x109/L)
13
31.7
28
68.3
DISCUSSION
Nowadays, canine ehrlichiosis and anaplasmosis have gained greater importance worldwide, which is mainly attributed to the fact that their vector (Rhipicephalus sanguineus) is considered the tick species with the widest geographical distribution (Aguiar et al., 2007;Parola et al., 2013; Cabezas-Cruz et al., 2019). In this research work, it was found that of the total number of dogs evaluated (384), 103 were positive for E. canis (26.8 %) by PCR technique and only 41 (10.7 %) through blood smear evaluation. This discrepancy of the two methods used is similar to that reported by Happi et al., (2018), who out of a total of116 dog samples only 10.3% were positive by microscopy, compared to the PCR technique where 42 positive results were obtained (36.2%). These results were to be expected, since although the diagnosis by microscopic visualization of the typical intracellular inclusions or morulae within the cytoplasm of monocytes or lymphocytes in peripheral blood smears (Figure 3) has been of great importance. This technique has certain disadvantages, such as lack of sensitivity during the early phase of infection, when there is low bacteremia, or when the bacterium multiplies in intracytoplasmic microcolonies in lymphoid organs. It will acquire mechanisms that ensure evasion of the immune response within the host cell (Bai et al., 2017;Manasa et al. 2017;McClure et al., 2017;Tominello et al., 2019;Franco-Zetina et al., 2019). In addition, false negatives have been reported in chronic or transient cases, because morulae usually disappear five to eight days after infection, as revealed in experimental studies in dogs and cattle (Gal et al., 2008;Stuen et al., 2013).
In Mexico, these diseases are frequently underdiagnosed, with few studies that determine their prevalence. In 2009 in Yucatan, a seroprevalence of canine ehrlichiosis of 45% was recorded (Jiménez-Coello et al., 2009) and in another investigation involving 28 states of the Mexican Republic. The presence of antibodies against Anaplasma spp, Borrelia burgdorferi and E. canis; registering a high prevalence for E. canis (55%) and moderate for Anaplasma spp (16.4%), for some northeastern states such as Coahuila and Nuevo
León (Movilla et al., 2016). Geographically, the animals that participated in this study belong to the northeastern zone of Mexico; however, if we compare the prevalence obtained in the central zone of Tamaulipas for E. canis (26.8%) with these two states, it would be much lower. However, it is important to mention that serological tests were used in this study, which may have the disadvantage of cross-reacting with other closely related microorganisms, overestimating the prevalence results and suggesting the need to carry out studies with molecular techniques that allow more accurate evidence of the type of pathogen involved (Cetinkaya et al., 2016).
In 2019, a molecular detection study of E. canis was conducted in rural areas of Yucatan, finding a 29.26% prevalence (Ojeda-Chi et al., 2019), which is close to that reported in this work (26.8%); but much higher compared to the prevalence found in dogs evaluated in the Comarca Lagunera (4%) (Almazán et al., 2016).
As for A. phagocytophilum infections, they have been increasingly diagnosed in companion and farm animals’ worldwide (McMahan et al., 2016). In Mexico, A. phagocytophilum, has been detected in opossums and dogs in Campeche state, with a prevalence of 3 and 27%, respectively (Rojero et al., 2017); however, in this work none of the dogs tested were positive by PCR or blood smear. This is not surprising, since Ixodes spp. and Dermacentor spp. ticks, infrequent in the study area, have been recognized as the most important vectors in the transmission cycle of this bacterium, which could have contributed to its null presence (Tinoco-García et al., 2009;Guzmán-Cornejo et al., 2016;Rodríguez-Vivas et al. 2019).
The results observed in this research show that E. canis has no predilection between gender, since within the infected group the percentages of females (29.7) and males (24.0) were not statistically significant (p>0.005). This same variable has been studied by several authors (Nuñez, 2003;Rodríguez-Vivas et al., 2005), finding similar results. However, this disagrees with what has been reported by other researchers, where they argue that females, especially during estrus, pregnancy or parturition, favor the risk of contracting E. canis infections (Salazar et al., 2014;Abdelfattah et al., 2021).
In relation to hematological findings associated with the presence of canine ehrlichiosis and anaplasmosis, it has been reported that these alterations will depend on the disease stage (Afusat et al., 2020). During the acute stage, the presence of anaemia is common, which is usually mild to moderate (usually normocytic, normochromic, non-regenerative) (Eberts et al., 2011).
In this work, the presence of anaemia was not significantly related to any of the diseases. Thrombocytopenia has been a hematological finding that has traditionally been associated with canine ehrlichiosis (Piratae et al., 2019). However, in this study the presence of thrombocytopenia (<200,000) had no association with E. canis positive animals. Several studies have reported an association between platelet count and the presence of E. canis, particularly in animals with platelet cell counts below 100 X109/L (Bulla et al., 2004; Tngsahuan et al., 2020). Although in the study many animals were reported with the presence of anaemia and hyperproteinemia, there is no significant statistical association when compared with animals that tested negative. This may be due to the possible presence of other hemoparasites such as Ehrlichia ewingii or Anaplasma platys that can produce degrees of anaemia and hyperproteinemia similar to those reported in dogs infected with E. canis (Piratae et al., 2019).
On the other hand, it is possible that many of the E. canis-positive individuals with unaltered hematological results had been in the subclinical phase of the disease. The latter would be of great importance since if the disease is not detected during this phase it could progress to a chronic stage, producing severe irreversible damage such as thrombocytopenia, leukopenia and severe non-regenerative anaemia resulting from bone marrow suppression (Little et al., 2014).
Regarding the evaluation of the white series, it is observed that despite the existence of significant differences between negative and positive cases to E. canis for total leukocyte, neutrophil and monocyte counts; the results were not as expected, since the negative dogs resulted with more alterations in these cells (either increased or decreased), compared to the positive ones. These findings are in agreement with the results obtained by Asgarali and colaboradores (2012), who reported that dogs with Ehrlichiosis manifested neutrophil and monocyte levels within reference ranges; in contrast to negative animals, which had a significant increase in these cells. A possible explanation for why many of the positive dogs showed no alterations in the white series is that these animals may have been in the subclinical phase of the disease, where most of them are asymptomatic and do not present significant hematological alterations (de Castro et al., 2004).
CONCLUSIONS
The present study showed that the hematological alterations evaluated in dogs with suspicious signs of Ehrlichia canis were not specific, since a large number of these animals were not infected. On the other hand, many of the dogs that did test positive remained without apparent changes in their blood counts, which is of great relevance, since these individuals, if not diagnosed in time, could be reservoirs for other hosts including humans. In addition, the veterinary clinician should consider that these diseases could present a subclinical picture without signs or with the presence of co-infections that produce similar signs, which would hinder their diagnosis and therefore the adequate treatment. Further research is suggested that includes the detection of other species of hemoparasites in the region, due to their importance as potentially zoonotic agents.
ACKNOWLEDGMENTS
To PRODEP Project No. 511-6/2019.-13905 entitled "Molecular evidence of tick-borne pathogens and their association with hematological changes in naturally infected canines in Cd. Victoria, Tam., Mexico" awarded by the promotion to Generation and Innovative Application of Knowledge (GAC) as part of the Support for the reincorporation of Former Scholarship Holders.